ID: 1118024069

View in Genome Browser
Species Human (GRCh38)
Location 14:61751165-61751187
Sequence CTGCGCCCGAGCACGTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024069_1118024073 4 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024073 14:61751192-61751214 GCAGTCCCGGGCCCCGCCCGCGG No data
1118024069_1118024071 -8 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024071 14:61751180-61751202 GGGCGCAGCACCGCAGTCCCGGG No data
1118024069_1118024070 -9 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024070 14:61751179-61751201 CGGGCGCAGCACCGCAGTCCCGG No data
1118024069_1118024081 17 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
1118024069_1118024084 24 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024084 14:61751212-61751234 CGGCCCCGGCCGTGGGCTCCAGG No data
1118024069_1118024079 16 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
1118024069_1118024076 10 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024076 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG No data
1118024069_1118024085 25 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024085 14:61751213-61751235 GGCCCCGGCCGTGGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024069 Original CRISPR CTGCGCCCGAGCACGTACTG AGG (reversed) Intergenic
No off target data available for this crispr