ID: 1118024072

View in Genome Browser
Species Human (GRCh38)
Location 14:61751190-61751212
Sequence GCGGGCGGGGCCCGGGACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024072_1118024090 16 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024072_1118024079 -9 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
1118024072_1118024085 0 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024085 14:61751213-61751235 GGCCCCGGCCGTGGGCTCCAGGG No data
1118024072_1118024084 -1 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024084 14:61751212-61751234 CGGCCCCGGCCGTGGGCTCCAGG No data
1118024072_1118024081 -8 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024081 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024072 Original CRISPR GCGGGCGGGGCCCGGGACTG CGG (reversed) Intergenic