ID: 1118024074

View in Genome Browser
Species Human (GRCh38)
Location 14:61751197-61751219
Sequence CGGGGCCGCGGGCGGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024074_1118024085 -7 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024085 14:61751213-61751235 GGCCCCGGCCGTGGGCTCCAGGG No data
1118024074_1118024094 30 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024074_1118024090 9 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024074_1118024084 -8 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024084 14:61751212-61751234 CGGCCCCGGCCGTGGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024074 Original CRISPR CGGGGCCGCGGGCGGGGCCC GGG (reversed) Intergenic