ID: 1118024077

View in Genome Browser
Species Human (GRCh38)
Location 14:61751203-61751225
Sequence CACGGCCGGGGCCGCGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024077_1118024095 25 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024095 14:61751251-61751273 GCGACTTTCGTGTACGCTGTGGG No data
1118024077_1118024097 29 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024077_1118024090 3 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024077_1118024094 24 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024077_1118024096 26 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024077 Original CRISPR CACGGCCGGGGCCGCGGGCG GGG (reversed) Intergenic