ID: 1118024079

View in Genome Browser
Species Human (GRCh38)
Location 14:61751204-61751226
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024072_1118024079 -9 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
1118024067_1118024079 21 Left 1118024067 14:61751160-61751182 CCACGCCTCAGTACGTGCTCGGG No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
1118024069_1118024079 16 Left 1118024069 14:61751165-61751187 CCTCAGTACGTGCTCGGGCGCAG No data
Right 1118024079 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024079 Original CRISPR CCCGCCCGCGGCCCCGGCCG TGG Intergenic
No off target data available for this crispr