ID: 1118024082

View in Genome Browser
Species Human (GRCh38)
Location 14:61751208-61751230
Sequence GAGCCCACGGCCGGGGCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024082_1118024094 19 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024082_1118024096 21 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024082_1118024095 20 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024095 14:61751251-61751273 GCGACTTTCGTGTACGCTGTGGG No data
1118024082_1118024090 -2 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024082_1118024097 24 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024082 Original CRISPR GAGCCCACGGCCGGGGCCGC GGG (reversed) Intergenic