ID: 1118024087

View in Genome Browser
Species Human (GRCh38)
Location 14:61751216-61751238
Sequence GAGCCCTGGAGCCCACGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024087_1118024095 12 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024095 14:61751251-61751273 GCGACTTTCGTGTACGCTGTGGG No data
1118024087_1118024096 13 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024087_1118024097 16 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024087_1118024094 11 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024087_1118024090 -10 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024087 Original CRISPR GAGCCCTGGAGCCCACGGCC GGG (reversed) Intergenic