ID: 1118024090

View in Genome Browser
Species Human (GRCh38)
Location 14:61751229-61751251
Sequence TCCAGGGCTCCAGCCGCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024078_1118024090 2 Left 1118024078 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024075_1118024090 8 Left 1118024075 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024080_1118024090 1 Left 1118024080 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024082_1118024090 -2 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024077_1118024090 3 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024072_1118024090 16 Left 1118024072 14:61751190-61751212 CCGCAGTCCCGGGCCCCGCCCGC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024087_1118024090 -10 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024083_1118024090 -3 Left 1118024083 14:61751209-61751231 CCGCGGCCCCGGCCGTGGGCTCC No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024074_1118024090 9 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data
1118024086_1118024090 -9 Left 1118024086 14:61751215-61751237 CCCCGGCCGTGGGCTCCAGGGCT No data
Right 1118024090 14:61751229-61751251 TCCAGGGCTCCAGCCGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024090 Original CRISPR TCCAGGGCTCCAGCCGCGCA AGG Intergenic