ID: 1118024094

View in Genome Browser
Species Human (GRCh38)
Location 14:61751250-61751272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024075_1118024094 29 Left 1118024075 14:61751198-61751220 CCGGGCCCCGCCCGCGGCCCCGG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024087_1118024094 11 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024088_1118024094 10 Left 1118024088 14:61751217-61751239 CCGGCCGTGGGCTCCAGGGCTCC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024077_1118024094 24 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024083_1118024094 18 Left 1118024083 14:61751209-61751231 CCGCGGCCCCGGCCGTGGGCTCC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024078_1118024094 23 Left 1118024078 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024074_1118024094 30 Left 1118024074 14:61751197-61751219 CCCGGGCCCCGCCCGCGGCCCCG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024080_1118024094 22 Left 1118024080 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024089_1118024094 6 Left 1118024089 14:61751221-61751243 CCGTGGGCTCCAGGGCTCCAGCC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024082_1118024094 19 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024091_1118024094 -3 Left 1118024091 14:61751230-61751252 CCAGGGCTCCAGCCGCGCAAGGC No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data
1118024086_1118024094 12 Left 1118024086 14:61751215-61751237 CCCCGGCCGTGGGCTCCAGGGCT No data
Right 1118024094 14:61751250-61751272 GGCGACTTTCGTGTACGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024094 Original CRISPR GGCGACTTTCGTGTACGCTG TGG Intergenic