ID: 1118024096

View in Genome Browser
Species Human (GRCh38)
Location 14:61751252-61751274
Sequence CGACTTTCGTGTACGCTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024077_1118024096 26 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024087_1118024096 13 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024088_1118024096 12 Left 1118024088 14:61751217-61751239 CCGGCCGTGGGCTCCAGGGCTCC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024091_1118024096 -1 Left 1118024091 14:61751230-61751252 CCAGGGCTCCAGCCGCGCAAGGC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024080_1118024096 24 Left 1118024080 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024083_1118024096 20 Left 1118024083 14:61751209-61751231 CCGCGGCCCCGGCCGTGGGCTCC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024086_1118024096 14 Left 1118024086 14:61751215-61751237 CCCCGGCCGTGGGCTCCAGGGCT No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024092_1118024096 -9 Left 1118024092 14:61751238-61751260 CCAGCCGCGCAAGGCGACTTTCG No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024078_1118024096 25 Left 1118024078 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024089_1118024096 8 Left 1118024089 14:61751221-61751243 CCGTGGGCTCCAGGGCTCCAGCC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data
1118024082_1118024096 21 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024096 14:61751252-61751274 CGACTTTCGTGTACGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024096 Original CRISPR CGACTTTCGTGTACGCTGTG GGG Intergenic