ID: 1118024097

View in Genome Browser
Species Human (GRCh38)
Location 14:61751255-61751277
Sequence CTTTCGTGTACGCTGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024086_1118024097 17 Left 1118024086 14:61751215-61751237 CCCCGGCCGTGGGCTCCAGGGCT No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024088_1118024097 15 Left 1118024088 14:61751217-61751239 CCGGCCGTGGGCTCCAGGGCTCC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024083_1118024097 23 Left 1118024083 14:61751209-61751231 CCGCGGCCCCGGCCGTGGGCTCC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024082_1118024097 24 Left 1118024082 14:61751208-61751230 CCCGCGGCCCCGGCCGTGGGCTC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024080_1118024097 27 Left 1118024080 14:61751205-61751227 CCGCCCGCGGCCCCGGCCGTGGG No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024093_1118024097 -10 Left 1118024093 14:61751242-61751264 CCGCGCAAGGCGACTTTCGTGTA No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024092_1118024097 -6 Left 1118024092 14:61751238-61751260 CCAGCCGCGCAAGGCGACTTTCG No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024089_1118024097 11 Left 1118024089 14:61751221-61751243 CCGTGGGCTCCAGGGCTCCAGCC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024091_1118024097 2 Left 1118024091 14:61751230-61751252 CCAGGGCTCCAGCCGCGCAAGGC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024087_1118024097 16 Left 1118024087 14:61751216-61751238 CCCGGCCGTGGGCTCCAGGGCTC No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024078_1118024097 28 Left 1118024078 14:61751204-61751226 CCCGCCCGCGGCCCCGGCCGTGG No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data
1118024077_1118024097 29 Left 1118024077 14:61751203-61751225 CCCCGCCCGCGGCCCCGGCCGTG No data
Right 1118024097 14:61751255-61751277 CTTTCGTGTACGCTGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024097 Original CRISPR CTTTCGTGTACGCTGTGGGG TGG Intergenic