ID: 1118024163

View in Genome Browser
Species Human (GRCh38)
Location 14:61751741-61751763
Sequence ACTTGGTGCCGTTTTTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118024159_1118024163 6 Left 1118024159 14:61751712-61751734 CCTAGTTAAGGATCTCGAAACTT No data
Right 1118024163 14:61751741-61751763 ACTTGGTGCCGTTTTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118024163 Original CRISPR ACTTGGTGCCGTTTTTATTT TGG Intergenic
No off target data available for this crispr