ID: 1118027155

View in Genome Browser
Species Human (GRCh38)
Location 14:61781157-61781179
Sequence TAAGAATTGTTGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2804
Summary {0: 1, 1: 9, 2: 70, 3: 503, 4: 2221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118027148_1118027155 30 Left 1118027148 14:61781104-61781126 CCTGGAACTAATCCTCCATGGAT 0: 4
1: 40
2: 192
3: 521
4: 937
Right 1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG 0: 1
1: 9
2: 70
3: 503
4: 2221
1118027150_1118027155 15 Left 1118027150 14:61781119-61781141 CCATGGATACTGAGAGACAGCTA 0: 1
1: 3
2: 20
3: 106
4: 377
Right 1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG 0: 1
1: 9
2: 70
3: 503
4: 2221
1118027149_1118027155 18 Left 1118027149 14:61781116-61781138 CCTCCATGGATACTGAGAGACAG 0: 1
1: 5
2: 31
3: 117
4: 470
Right 1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG 0: 1
1: 9
2: 70
3: 503
4: 2221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118027155 Original CRISPR TAAGAATTGTTGGCCGGGTG CGG Intronic
Too many off-targets to display for this crispr