ID: 1118030429

View in Genome Browser
Species Human (GRCh38)
Location 14:61812901-61812923
Sequence GGCTCGCGGCAGCAGCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118030421_1118030429 26 Left 1118030421 14:61812852-61812874 CCGCGGTGCCCAGGGTGGGAAGT No data
Right 1118030429 14:61812901-61812923 GGCTCGCGGCAGCAGCGGCCGGG No data
1118030422_1118030429 18 Left 1118030422 14:61812860-61812882 CCCAGGGTGGGAAGTTCGATTTC No data
Right 1118030429 14:61812901-61812923 GGCTCGCGGCAGCAGCGGCCGGG No data
1118030423_1118030429 17 Left 1118030423 14:61812861-61812883 CCAGGGTGGGAAGTTCGATTTCA No data
Right 1118030429 14:61812901-61812923 GGCTCGCGGCAGCAGCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118030429 Original CRISPR GGCTCGCGGCAGCAGCGGCC GGG Intergenic
No off target data available for this crispr