ID: 1118031989

View in Genome Browser
Species Human (GRCh38)
Location 14:61826916-61826938
Sequence CCGTGTCCTTACCAGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118031979_1118031989 15 Left 1118031979 14:61826878-61826900 CCTTTTAATATTCCTGGCTTGCC No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031973_1118031989 23 Left 1118031973 14:61826870-61826892 CCCCAACCCCTTTTAATATTCCT No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031982_1118031989 3 Left 1118031982 14:61826890-61826912 CCTGGCTTGCCGGTGGCACCTTC No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031975_1118031989 21 Left 1118031975 14:61826872-61826894 CCAACCCCTTTTAATATTCCTGG No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031983_1118031989 -6 Left 1118031983 14:61826899-61826921 CCGGTGGCACCTTCTTTCCGTGT No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031977_1118031989 17 Left 1118031977 14:61826876-61826898 CCCCTTTTAATATTCCTGGCTTG No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031974_1118031989 22 Left 1118031974 14:61826871-61826893 CCCAACCCCTTTTAATATTCCTG No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data
1118031978_1118031989 16 Left 1118031978 14:61826877-61826899 CCCTTTTAATATTCCTGGCTTGC No data
Right 1118031989 14:61826916-61826938 CCGTGTCCTTACCAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118031989 Original CRISPR CCGTGTCCTTACCAGGGTGG AGG Intergenic
No off target data available for this crispr