ID: 1118034283

View in Genome Browser
Species Human (GRCh38)
Location 14:61849624-61849646
Sequence GAGGGAGAGCATAGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118034283_1118034290 20 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034290 14:61849667-61849689 TACCTCATGTGGCCACTGTCGGG No data
1118034283_1118034294 25 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034283_1118034288 9 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data
1118034283_1118034295 30 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034295 14:61849677-61849699 GGCCACTGTCGGGGTGGGAGAGG No data
1118034283_1118034291 21 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034291 14:61849668-61849690 ACCTCATGTGGCCACTGTCGGGG No data
1118034283_1118034293 24 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034293 14:61849671-61849693 TCATGTGGCCACTGTCGGGGTGG No data
1118034283_1118034289 19 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034289 14:61849666-61849688 TTACCTCATGTGGCCACTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118034283 Original CRISPR GAGGGAGAGCATAGTGATTG TGG (reversed) Intergenic