ID: 1118034286

View in Genome Browser
Species Human (GRCh38)
Location 14:61849646-61849668
Sequence TAAAGAATCTGTGCACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118034286_1118034295 8 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034295 14:61849677-61849699 GGCCACTGTCGGGGTGGGAGAGG No data
1118034286_1118034291 -1 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034291 14:61849668-61849690 ACCTCATGTGGCCACTGTCGGGG No data
1118034286_1118034300 19 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034300 14:61849688-61849710 GGGTGGGAGAGGGGTGGCATTGG No data
1118034286_1118034290 -2 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034290 14:61849667-61849689 TACCTCATGTGGCCACTGTCGGG No data
1118034286_1118034289 -3 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034289 14:61849666-61849688 TTACCTCATGTGGCCACTGTCGG No data
1118034286_1118034296 9 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034296 14:61849678-61849700 GCCACTGTCGGGGTGGGAGAGGG No data
1118034286_1118034299 13 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034299 14:61849682-61849704 CTGTCGGGGTGGGAGAGGGGTGG No data
1118034286_1118034294 3 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034286_1118034298 10 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034298 14:61849679-61849701 CCACTGTCGGGGTGGGAGAGGGG No data
1118034286_1118034293 2 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034293 14:61849671-61849693 TCATGTGGCCACTGTCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118034286 Original CRISPR TAAAGAATCTGTGCACTTGA GGG (reversed) Intergenic