ID: 1118034288

View in Genome Browser
Species Human (GRCh38)
Location 14:61849656-61849678
Sequence CACAGATTCTTTACCTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118034284_1118034288 -9 Left 1118034284 14:61849642-61849664 CCCTCCCTCAAGTGCACAGATTC No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data
1118034281_1118034288 22 Left 1118034281 14:61849611-61849633 CCAATGCAAAGTCCCACAATCAC No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data
1118034282_1118034288 10 Left 1118034282 14:61849623-61849645 CCCACAATCACTATGCTCTCCCT No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data
1118034283_1118034288 9 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data
1118034285_1118034288 -10 Left 1118034285 14:61849643-61849665 CCTCCCTCAAGTGCACAGATTCT No data
Right 1118034288 14:61849656-61849678 CACAGATTCTTTACCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118034288 Original CRISPR CACAGATTCTTTACCTCATG TGG Intergenic