ID: 1118034294

View in Genome Browser
Species Human (GRCh38)
Location 14:61849672-61849694
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118034283_1118034294 25 Left 1118034283 14:61849624-61849646 CCACAATCACTATGCTCTCCCTC No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034282_1118034294 26 Left 1118034282 14:61849623-61849645 CCCACAATCACTATGCTCTCCCT No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034286_1118034294 3 Left 1118034286 14:61849646-61849668 CCCTCAAGTGCACAGATTCTTTA No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034287_1118034294 2 Left 1118034287 14:61849647-61849669 CCTCAAGTGCACAGATTCTTTAC No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034285_1118034294 6 Left 1118034285 14:61849643-61849665 CCTCCCTCAAGTGCACAGATTCT No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data
1118034284_1118034294 7 Left 1118034284 14:61849642-61849664 CCCTCCCTCAAGTGCACAGATTC No data
Right 1118034294 14:61849672-61849694 CATGTGGCCACTGTCGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118034294 Original CRISPR CATGTGGCCACTGTCGGGGT GGG Intergenic