ID: 1118036941

View in Genome Browser
Species Human (GRCh38)
Location 14:61877966-61877988
Sequence CTGCCAGTATACCTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118036938_1118036941 -3 Left 1118036938 14:61877946-61877968 CCCAGGCACACAGGCACACACTG No data
Right 1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG No data
1118036939_1118036941 -4 Left 1118036939 14:61877947-61877969 CCAGGCACACAGGCACACACTGC No data
Right 1118036941 14:61877966-61877988 CTGCCAGTATACCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118036941 Original CRISPR CTGCCAGTATACCTTGCCCT GGG Intergenic
No off target data available for this crispr