ID: 1118046793

View in Genome Browser
Species Human (GRCh38)
Location 14:61978768-61978790
Sequence GTGGACTAAAGCAGTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118046793_1118046796 -6 Left 1118046793 14:61978768-61978790 CCTCCCTCACTGCTTTAGTCCAC No data
Right 1118046796 14:61978785-61978807 GTCCACCTTGTGAGCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118046793 Original CRISPR GTGGACTAAAGCAGTGAGGG AGG (reversed) Intergenic
No off target data available for this crispr