ID: 1118050346

View in Genome Browser
Species Human (GRCh38)
Location 14:62019797-62019819
Sequence CGGGCACTGACCGCTTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118050340_1118050346 12 Left 1118050340 14:62019762-62019784 CCTGTTCCACCCTATGAGGTGTG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 71
1118050341_1118050346 6 Left 1118050341 14:62019768-62019790 CCACCCTATGAGGTGTGATTGCA 0: 1
1: 0
2: 2
3: 21
4: 1087
Right 1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 71
1118050343_1118050346 2 Left 1118050343 14:62019772-62019794 CCTATGAGGTGTGATTGCAGTGC 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 71
1118050339_1118050346 13 Left 1118050339 14:62019761-62019783 CCCTGTTCCACCCTATGAGGTGT 0: 1
1: 0
2: 8
3: 13
4: 118
Right 1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 71
1118050342_1118050346 3 Left 1118050342 14:62019771-62019793 CCCTATGAGGTGTGATTGCAGTG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG 0: 1
1: 0
2: 2
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118050346 Original CRISPR CGGGCACTGACCGCTTTTCC TGG Intronic
901772581 1:11537833-11537855 TGGGCACTGAGCTCTTTCCCTGG + Intergenic
902394780 1:16126664-16126686 CGTGGTCTGAGCGCTTTTCCAGG - Intronic
915335236 1:155137039-155137061 CTGGCACTGCCACCTTTTCCAGG + Intronic
918080808 1:181206524-181206546 CAGGCACTGACCTCCTTTTCGGG - Intergenic
920108271 1:203569696-203569718 TGGGCACTGTCCTCTCTTCCTGG + Intergenic
920165648 1:204033827-204033849 CAGGCACTGACAGCATTTCTTGG + Intergenic
920573273 1:207034323-207034345 CGGGCTATGACCTCTTTCCCTGG + Intronic
920745529 1:208624427-208624449 CGGGCACTTTCTGCTTTCCCTGG + Intergenic
923035097 1:230280155-230280177 CGGGCTCTGGCCCCTTCTCCCGG - Exonic
1070713665 10:78701934-78701956 CGGGCACCCACTGCTTTTCAAGG + Intergenic
1072998472 10:100267395-100267417 CCGGGGCTGACCTCTTTTCCTGG - Intronic
1088907495 11:114165664-114165686 CTGGCACTGACCCCTTTCCTGGG - Intronic
1090772220 11:129931275-129931297 CCGGCACTGATCTCTATTCCTGG - Intronic
1091855371 12:3735263-3735285 CCTGCACTCACCTCTTTTCCAGG - Intronic
1101957437 12:109223383-109223405 AGGGCACTGATCGCTTTTAGTGG + Intronic
1103362407 12:120361861-120361883 CGGCCGCTGACGGCTTCTCCTGG + Intronic
1104409602 12:128547145-128547167 CTGGCACTGACTGCTTCTGCTGG - Intronic
1105931340 13:25055685-25055707 CTGGCACTGAGCTGTTTTCCTGG + Intergenic
1110818522 13:79887299-79887321 CGGGGAGTGCCCGCTTTTCCAGG - Intergenic
1110939303 13:81329435-81329457 CTGGCACTGACGTCTTTTCCGGG + Intergenic
1118050346 14:62019797-62019819 CGGGCACTGACCGCTTTTCCTGG + Intronic
1122072851 14:99215938-99215960 CCGGCACTGCCCTCTGTTCCTGG - Intronic
1128021073 15:64390920-64390942 CGGGCACTGACCTCCTTCCCAGG - Intronic
1128249057 15:66152136-66152158 TGGGCACTGCCAGCTTCTCCAGG + Intronic
1133017586 16:2951417-2951439 TGGGCACTGACCGCCCTCCCAGG + Intergenic
1139700677 16:68706308-68706330 AGGGCACTGGCCGCTGCTCCTGG - Intronic
1140504600 16:75463759-75463781 AGGGCACGGAGCGCTCTTCCTGG + Intronic
1140512399 16:75517495-75517517 CGGGCAGGGGCCGCTTCTCCAGG - Intergenic
1141519212 16:84566515-84566537 CCTGCAGTGACCCCTTTTCCTGG - Exonic
1142028310 16:87825990-87826012 CGGGCACTTACCACTATGCCTGG - Intergenic
1144306146 17:13971105-13971127 CGGGCAGTGGCAGCTTGTCCAGG + Intergenic
1152009162 17:77700326-77700348 AGGGCACTGACAGGTCTTCCTGG + Intergenic
1152273736 17:79341654-79341676 GGGGCAGTGACTGCTTCTCCAGG - Intronic
1158850980 18:61495732-61495754 GGGGCACTGGCTGTTTTTCCTGG + Intronic
1162423319 19:10578692-10578714 CAGGCACTCACCACTTTACCAGG + Intronic
1164762787 19:30740413-30740435 TGGACACTGCCCGCTATTCCCGG + Intergenic
1168078258 19:53992036-53992058 CGGCCACCGGCCCCTTTTCCAGG + Intergenic
936010015 2:108919652-108919674 CTGGCCCTGACTGCTTTTCTAGG + Intronic
937147076 2:119656737-119656759 CGGGCACTGGCAGCTGTTTCTGG + Intronic
938244388 2:129765766-129765788 CGGCCACTGACATCGTTTCCTGG - Intergenic
942104510 2:172619413-172619435 CGGGCAGTGTCTGCTTTTCCTGG - Intergenic
942631340 2:177952865-177952887 CAGGCAATTACTGCTTTTCCTGG + Intronic
1173059791 20:39650581-39650603 CTGGCTCTGTCCGCTGTTCCTGG + Intergenic
1175256945 20:57653236-57653258 CTGGCCCTGGGCGCTTTTCCAGG + Intronic
1176367225 21:6040421-6040443 CTGGAACTGTCCGCTTTGCCCGG + Intergenic
1176911926 21:14576380-14576402 CAGGCACAGACAGCTTATCCCGG + Intronic
1179756294 21:43498125-43498147 CTGGAACTGTCCGCTTTGCCCGG - Intergenic
1183058866 22:35323206-35323228 CCTGCACTGACAGCTCTTCCTGG - Intronic
1184390332 22:44200053-44200075 CGGGCACTGAAGGCTGTACCTGG - Intronic
965543167 3:169890470-169890492 CGAGCTCTGAGGGCTTTTCCAGG + Intergenic
968299887 3:197604320-197604342 CGGGCAGTGACCGCATCGCCCGG + Intergenic
991330188 5:65485511-65485533 CGAGCACTGCCCGCTGCTCCAGG - Intergenic
995981645 5:118111735-118111757 CTGGCACTGACCTCCTTCCCTGG - Intergenic
1001105721 5:168852450-168852472 TGGGCACTGACCTCCTATCCAGG - Intronic
1005739312 6:28775653-28775675 TTGACACTGCCCGCTTTTCCAGG - Intergenic
1009918828 6:70030900-70030922 GGGGCTATGACAGCTTTTCCAGG - Intronic
1016073364 6:139767785-139767807 CGGGTTCTGTACGCTTTTCCAGG + Intergenic
1024246087 7:47471523-47471545 CGGGCCCTGCCAGCCTTTCCTGG + Intronic
1025757693 7:64360359-64360381 AGGGCACTGACTTCTTTCCCAGG - Intergenic
1026057432 7:66996753-66996775 CGGGCACTGGCTTCCTTTCCCGG + Intronic
1026381798 7:69807509-69807531 AGAGCAATGACCTCTTTTCCCGG - Intronic
1026720676 7:72828279-72828301 CGGGCACTGGCTTCCTTTCCCGG - Intergenic
1028446830 7:90934112-90934134 TGGGCACTGACCGCCTTTCCAGG - Intronic
1031553438 7:123143035-123143057 AGGGCACTGGCCCCCTTTCCAGG - Intronic
1038083928 8:24173099-24173121 GGAGCACTAACCACTTTTCCTGG - Intergenic
1040585936 8:48741260-48741282 TGGGCACTGACCCTTTTTGCTGG + Intergenic
1043625621 8:82254299-82254321 CTGGCACAAACCGCTTTACCTGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1047319960 8:123769435-123769457 CTGGCCCTGACCACTTTTCCAGG - Intronic
1049272098 8:141701300-141701322 CCCGCACTGGCCTCTTTTCCTGG - Intergenic
1051352936 9:16215342-16215364 CGGGAACAGAACGCTTTCCCTGG + Intronic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1061820926 9:133226825-133226847 CTGGCACTGGCCACTTATCCTGG + Intergenic
1190282082 X:48937585-48937607 CTGCCACTGACCCCTTTGCCTGG + Intronic
1191643658 X:63454880-63454902 CGGGCTCTTACCACTTTTCTCGG - Intergenic
1196992926 X:121347802-121347824 CCGGCAAGTACCGCTTTTCCAGG - Intergenic
1199757828 X:150881509-150881531 CGGGCACTGACTGTGTTTCAAGG - Intronic
1200053335 X:153446015-153446037 CGGGCACTGACCGGCTTCCTGGG + Exonic