ID: 1118054424

View in Genome Browser
Species Human (GRCh38)
Location 14:62064611-62064633
Sequence ATGGGGAAACAGATGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118054417_1118054424 0 Left 1118054417 14:62064588-62064610 CCAGAATTTAAGAAGTTTTTTCC 0: 1
1: 0
2: 1
3: 31
4: 355
Right 1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 438
1118054416_1118054424 9 Left 1118054416 14:62064579-62064601 CCATTTTGTCCAGAATTTAAGAA 0: 1
1: 1
2: 1
3: 30
4: 347
Right 1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG 0: 1
1: 0
2: 4
3: 39
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118054424 Original CRISPR ATGGGGAAACAGATGGTAGA GGG Intronic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
902713351 1:18255697-18255719 ATGGGGAAACAGTAGGAAGGGGG - Intronic
902980251 1:20117615-20117637 TGGGAGAAACAGATGGCAGAAGG + Intronic
903614101 1:24639657-24639679 ATGGGAAACCAGAAGGTTGAAGG + Intronic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904816321 1:33203148-33203170 ATGGAGAATAAAATGGTAGATGG - Intergenic
905782299 1:40722640-40722662 ATGGTAAAACACATGTTAGAAGG - Intronic
905791599 1:40792486-40792508 GTGGGGAAACTGAGGCTAGAAGG + Intronic
906269843 1:44467969-44467991 ATGGGGAAATAGCTGGTCGGTGG + Intronic
908668112 1:66514906-66514928 TTGGGGAAACAGGTGGTATTTGG - Intergenic
909862997 1:80632646-80632668 ATGGGGAGCCAGAGGGGAGATGG - Intergenic
909952945 1:81740933-81740955 ATGGGGAAAGACATGGTTAAAGG + Intronic
911146586 1:94558190-94558212 ATCTGGAAACAGATGGCAGCTGG - Intergenic
913290281 1:117265561-117265583 ATAGGGAAAGAAATGGAAGAAGG - Intergenic
914733618 1:150395027-150395049 ATTGGGAAACAGGTGGTATTTGG + Intronic
914805115 1:150985902-150985924 AAAGGGAAACAGATGCAAGAAGG - Intronic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
915799998 1:158780821-158780843 GTGCTGACACAGATGGTAGAAGG - Intergenic
915824541 1:159061304-159061326 ATGGGCAAAAAGATGATACATGG - Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916997611 1:170317381-170317403 ATGAGGAAACTGAAGGTAAATGG + Intergenic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
917981511 1:180272345-180272367 AAGGGGACAAAGATGGGAGAGGG - Intronic
918211596 1:182356280-182356302 TTGGGGAAAGGGATGGTAAAGGG + Intergenic
918512996 1:185331710-185331732 TTGGGGAAACAGATGATATTTGG + Intergenic
919201882 1:194365694-194365716 ATGGGGAAACAAAGGGTAGAAGG - Intergenic
921395477 1:214664775-214664797 ATGGGGACACAGAATGTAGGAGG - Intergenic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
924305566 1:242685196-242685218 ATGTGGAAACAGATGTTAAAGGG + Intergenic
924376211 1:243412062-243412084 ATGGCCAAACAGAAAGTAGATGG - Intronic
924512958 1:244742859-244742881 ATTGGGGAACAGATGGTATTTGG + Intergenic
924596982 1:245454965-245454987 AAGGAGAAACACATGGTAGGTGG + Intronic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063135335 10:3211607-3211629 ATGGGGAAACAGATTTGAAATGG - Intergenic
1063628087 10:7709538-7709560 ATAGAGAAACATATGGCAGATGG - Intronic
1065169832 10:23015725-23015747 ATGGGTAAAAAGAGGGTAGTGGG - Intronic
1065490810 10:26279859-26279881 ATTAGGAAACAGATGGAAGCAGG + Intronic
1066057165 10:31692697-31692719 ATGGGGGAACAGCTGGTAAGTGG + Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1067170845 10:43904607-43904629 CTGGGGAAACAGCTTGCAGAGGG - Intergenic
1067303904 10:45040548-45040570 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1070832863 10:79430960-79430982 ATGGGGAAACAGATGCTTCGAGG - Intronic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1072868339 10:99088232-99088254 TTGGGGAAACAGGTGGTATTTGG + Intronic
1074642605 10:115404401-115404423 ATGAGGAAACAGAGGGTGTATGG - Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1074951841 10:118344401-118344423 ATGGGGAAAGAGATAGCAGAGGG + Intergenic
1076983499 11:218627-218649 ATGAGGAAACAGATGCTAACAGG - Intronic
1077810616 11:5632777-5632799 ATGGGGCAGAAGATGGTAGTTGG + Intronic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078459060 11:11499570-11499592 ACGGGGACACAGATAGCAGATGG - Intronic
1078517095 11:12031991-12032013 AAAGGGAGACAGATGGTAGGAGG + Intergenic
1079303685 11:19303438-19303460 ATGGGGGAACAGCTGGTTGGTGG + Intergenic
1080272805 11:30468532-30468554 AAGGGGAAAAAGAGGGTAAAAGG + Intronic
1080872928 11:36252573-36252595 ATGGGGAAACTGAGGCTTGAGGG - Intergenic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083009938 11:59387531-59387553 AAGGGGTGACAGATGGTAGCTGG - Intergenic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084508634 11:69587448-69587470 ATGGGGAAACAGATGCTGAGGGG - Intergenic
1084874755 11:72123126-72123148 ATGGGGAAACTGAGGTTTGAAGG - Intronic
1084958529 11:72704015-72704037 ATGGGGAAACTGATGTTTGGAGG - Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087085269 11:94211895-94211917 AGGTGGAGACTGATGGTAGAGGG + Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088158867 11:106843376-106843398 TTTGGGAAACAGGTGGTAGTTGG - Intronic
1089128261 11:116192689-116192711 ATGAGGAAACTGAGGTTAGAGGG + Intergenic
1089183873 11:116601781-116601803 ATGGGGAAACTGAGGCTAAAGGG - Intergenic
1089309626 11:117549105-117549127 ATGGGGAAACACATGTAGGAAGG - Intronic
1089790868 11:120942520-120942542 ATCAGGAACCAGATGGCAGAAGG + Intronic
1090963411 11:131577122-131577144 ATGAGGAAACTGATGCTAAAAGG - Intronic
1091855502 12:3736139-3736161 ATGGGGAAGAAGATGGAAGGAGG + Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1093670266 12:21865912-21865934 GTGGGGTAAAAGATGGTAGTAGG + Intronic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1096572519 12:52531851-52531873 ATGGGGAAGTGGATGTTAGAGGG - Intergenic
1096762398 12:53852992-53853014 AAGGGGAAAGAGGTGGTAGGGGG - Intergenic
1097056389 12:56252440-56252462 TTAGAGAAACAAATGGTAGAGGG - Intronic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1097720867 12:63019785-63019807 CTGGGCAAACGGATGGTATAGGG + Intergenic
1098462064 12:70742779-70742801 CGGGGGAAACAGTTGGGAGAAGG + Intronic
1098534017 12:71574523-71574545 ATGGGTAGAGAGATGATAGAAGG - Intronic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1099745673 12:86701524-86701546 ATTGGGAAACAGCTGGTTGATGG - Intronic
1099800716 12:87452886-87452908 ATGGGGAAATACATGTTAAAGGG + Intergenic
1101259660 12:103015336-103015358 ATAGGTAAATAGATGATAGATGG - Intergenic
1101410568 12:104464443-104464465 AAGGGGGAGCAGGTGGTAGAGGG - Intronic
1101719652 12:107340467-107340489 AAGGGGGAAGAGATGGGAGAAGG - Intronic
1101720413 12:107345813-107345835 AAGAGGAAACAGTGGGTAGAAGG + Intronic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1102515815 12:113445923-113445945 AAGGGGAAAGAGAAAGTAGAGGG + Intergenic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1103675848 12:122655114-122655136 ATGGGGGATGAGATGGTAGACGG - Intergenic
1103879546 12:124155472-124155494 ATGGGGAAACTGTTGGGGGAAGG - Intronic
1103883422 12:124183833-124183855 ATGAGGAAACAGAGGCTCGATGG + Intronic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1106057216 13:26249663-26249685 ATGGGTGAATAGATGATAGATGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107721926 13:43258388-43258410 GTGGTGAAACAGCTGGAAGAAGG + Intronic
1108468272 13:50740997-50741019 ATGGGGAAGCAGGTGGTGGTAGG - Intronic
1108692103 13:52868687-52868709 ATGGGGCAACAGCTGGGAGGTGG + Intergenic
1109038966 13:57306038-57306060 AAGGGGAAACAGAGGGGAGTAGG - Intergenic
1109075745 13:57832471-57832493 ATGAGGAGACAGAAGGGAGATGG - Intergenic
1109636637 13:65127341-65127363 ATAGGTAAATAGATGATAGATGG + Intergenic
1109961164 13:69633965-69633987 ATGGGGAAAGAGAAGGAAGTGGG - Intergenic
1110735517 13:78931607-78931629 ATGGAGGAACAGCTGGTAGGTGG - Intergenic
1111742742 13:92225069-92225091 ATGGGGCAACAGGTGGTATGGGG - Intronic
1112659310 13:101489290-101489312 ATGGATAAACACATGGTAGATGG + Intronic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114563154 14:23607873-23607895 ATGGAGAAACAGGTGGCAGCTGG - Intergenic
1114571176 14:23669970-23669992 AGGGGGAAAGAGAGTGTAGAGGG - Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116499472 14:45602694-45602716 ATGGGGGAACAGCCGGTAGGTGG + Intergenic
1116924886 14:50624498-50624520 ATGGGGGAACTGCTGGTTGATGG - Intronic
1118054424 14:62064611-62064633 ATGGGGAAACAGATGGTAGAGGG + Intronic
1118919904 14:70140372-70140394 ATGGGGAAACAGAGGGTAAGAGG + Intronic
1119204590 14:72784569-72784591 TTGGGAAAGAAGATGGTAGAGGG - Intronic
1119388688 14:74275656-74275678 AGGGGGAGACAGATGGTAGGAGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119788299 14:77328645-77328667 ATGAGGAAACAGAGGGAAAATGG + Intronic
1120249012 14:82039148-82039170 ATGGGGAAATATATTGTAGTTGG + Intergenic
1121766788 14:96494720-96494742 ATGGGGGAGCAGCAGGTAGAGGG - Intergenic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1125194841 15:37034263-37034285 ATGGGGAAACAGAAAGTCCAGGG + Intronic
1125507295 15:40274166-40274188 ATGGTGATTGAGATGGTAGATGG + Exonic
1125981355 15:44004633-44004655 TTGGGGGAACAGCTGGTTGATGG - Intronic
1126330519 15:47526158-47526180 ATGGGGTACCAGCTGGTAGCAGG - Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127455162 15:59150335-59150357 ATAGGGAACCACATGGCAGAGGG + Intronic
1128250803 15:66163137-66163159 GTTGGGAAACAGAGGGCAGAGGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128379853 15:67104579-67104601 ATGGGAAAACAGCTGGAAAAAGG - Intronic
1128518919 15:68362553-68362575 ATGGATAGACAGATGATAGATGG + Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130353333 15:83109574-83109596 ATGGGGAAGCAGACAGTAGGAGG - Intronic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1131848476 15:96513116-96513138 ATGGGCACACAGATGATAGAGGG + Intergenic
1132712021 16:1273085-1273107 ATGGGTAGACAGATGGTAGATGG + Intergenic
1133222669 16:4325492-4325514 ATGGGGAAACTGAGGGCTGAAGG - Intronic
1133426542 16:5695506-5695528 ATGGGGAATTTGATGATAGATGG + Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133605579 16:7384580-7384602 ATGGGGAAATAGGAGGGAGAGGG + Intronic
1135288405 16:21213755-21213777 TTGGGGATAGAGATGGTAAAAGG + Intronic
1135330400 16:21555482-21555504 ATGGGGAAACTGAGGCTAGGAGG - Intergenic
1136253887 16:29025360-29025382 ATAGGGATACAGAAGGTAGCTGG + Intergenic
1137494234 16:48957331-48957353 TTGGGGAAACAGGTGGTACTTGG - Intergenic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138824808 16:60306278-60306300 ATGAGGAAACAAGTGTTAGAAGG - Intergenic
1139218765 16:65157288-65157310 GTGGGGAAACTGATGTTACAGGG - Intergenic
1140310613 16:73844810-73844832 ATGGGTAGACAGATGGTAGACGG + Intergenic
1141066986 16:80921942-80921964 ATTGGGGAACAGATGGTATTTGG + Intergenic
1141599383 16:85115968-85115990 TTGGGGAACCACATGGGAGAGGG + Intergenic
1141899339 16:86980379-86980401 ATGGATAAATAGATGATAGAGGG + Intergenic
1142043426 16:87909950-87909972 ATGGGGAAACTGAGGCTAGAAGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143737759 17:8925428-8925450 ATGGAGAGATAGATAGTAGATGG + Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144529042 17:16018402-16018424 ATGAGAAAACTGATGGAAGAGGG - Intronic
1146919542 17:36701247-36701269 ATTGTTGAACAGATGGTAGAGGG + Intergenic
1146935831 17:36812185-36812207 ATGAGGAAACTGAGGCTAGAAGG + Intergenic
1148137602 17:45304639-45304661 ATGGGGAAAAAATGGGTAGATGG + Intronic
1148701475 17:49589549-49589571 TTGGGTAAATAGAGGGTAGACGG + Intergenic
1149375120 17:56035988-56036010 AGGAGCACACAGATGGTAGAAGG - Intergenic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1152094771 17:78266729-78266751 ATGAGGAAACGGATAGCAGAGGG + Intergenic
1153492881 18:5667736-5667758 ATAGGGAAACAGCTGGTAAGTGG + Intergenic
1154229532 18:12542477-12542499 ATGGGAAAACAAATAGAAGATGG - Intronic
1154465634 18:14641185-14641207 ATGGGGAAAGAAAAGATAGACGG - Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155434090 18:25792982-25793004 ATGGGGAAAGAGAAAGCAGAGGG - Intergenic
1155671926 18:28381980-28382002 ATGGGAACACAGCTGGTAAAGGG + Intergenic
1155776628 18:29771196-29771218 AAGGGGATAGGGATGGTAGAAGG + Intergenic
1155982777 18:32197968-32197990 ATGGGAAAACATATGGTATTTGG + Intronic
1156412552 18:36846605-36846627 AAGGGGAAACAGACTGTAAAAGG - Intronic
1156459490 18:37313769-37313791 ATAGGGCTACAGATGGTGGAGGG + Intronic
1156650050 18:39214921-39214943 TTGAGGAAATACATGGTAGATGG + Intergenic
1156949389 18:42875502-42875524 ATGTGGAAACAGATGCTTGGTGG + Intronic
1157420981 18:47547243-47547265 ATGGGGAATTAGATGCAAGATGG + Intergenic
1157560468 18:48641884-48641906 AGGGGATAACAGATGGTAGGTGG + Intronic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1161938076 19:7384374-7384396 ATGGGCAAACAGATCCTAGATGG + Intronic
1162004280 19:7767349-7767371 ATGGGGATACAGATGTGAGAGGG + Intronic
1162085923 19:8249094-8249116 ATGGGCGAACAGATGGATGATGG + Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1163096057 19:15057988-15058010 ATGGTGGAAGAGATGGGAGATGG - Exonic
1164674118 19:30090587-30090609 CTGGGGAAACCGGTGGGAGAGGG + Intergenic
1165098346 19:33422693-33422715 ATGGGTAGATGGATGGTAGATGG - Intronic
1165873865 19:38992035-38992057 ATGGGGAAACAGTTTACAGACGG + Intronic
1166372181 19:42308063-42308085 ATGGGGAAACAGTTAAAAGATGG - Intronic
1166562230 19:43740550-43740572 ATGAGGAAACTGATGGAAAAAGG - Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167868466 19:52347295-52347317 ATGGGGAAAAAGATTTTAAATGG + Intronic
1168340491 19:55620618-55620640 ATGGGGAAACAGAAGCTTGGAGG + Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
926341489 2:11908364-11908386 AAGAGGAAACTGAGGGTAGAGGG + Intergenic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
927647097 2:24884832-24884854 AAGGGAAAAAAGATGGTAAAAGG - Intronic
928762362 2:34599805-34599827 ATGGAAAAACAGAAGGTAGGAGG - Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932474204 2:71991330-71991352 TTTGGGAAAGAGATGGTACAAGG - Intergenic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936478527 2:112863673-112863695 ATAAGAAAACAGATGGTGGATGG - Intergenic
937251205 2:120524923-120524945 AAAGGGAAACAGCAGGTAGAGGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
940327740 2:152443165-152443187 ATGGGGAACCAGATGGGTGGTGG + Intronic
940812989 2:158266495-158266517 TTGGGGAAACAGGTGGTATCTGG + Intronic
941974980 2:171393684-171393706 AGGTGGAAACAGATGCTAAAAGG + Intronic
942480662 2:176384877-176384899 ATGGGGAAACAGAAGTGATAGGG + Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943375734 2:187074423-187074445 ATGAGGAAACAGAAGATAAAAGG + Intergenic
943473809 2:188329700-188329722 ATGGGGACAAAGATGGAAGCAGG + Intronic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
944959913 2:204860439-204860461 ATGGAGAAACTGCTGGCAGATGG + Intronic
945061266 2:205910912-205910934 ATGAGGAACAAGATGGCAGATGG + Intergenic
945193565 2:207216118-207216140 AAAGGGAAGCAGGTGGTAGAAGG + Intergenic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946211390 2:218150108-218150130 ATGGGGGAAGAGATGGTGAAAGG - Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
948375737 2:237519199-237519221 AAGGGGAAGCAGCTGGAAGAAGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1171330559 20:24333985-24334007 ATGAGTAAACTGATGGCAGAAGG + Intergenic
1171501470 20:25596877-25596899 GTTGGTAGACAGATGGTAGATGG - Intergenic
1172312235 20:33927621-33927643 ATGAGGAAACAGATCATAGAGGG + Intergenic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172509099 20:35487521-35487543 AAGGGGAGACAGACAGTAGATGG - Intronic
1173082904 20:39886808-39886830 ATGTGGAAACAGATTGGAGGAGG - Intergenic
1173302442 20:41816228-41816250 ATGTGGAAGCAGAAGGCAGAAGG - Intergenic
1173305874 20:41848718-41848740 ATGTGGAAACAAATGGGACAGGG + Intergenic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173857561 20:46260498-46260520 ACGGGGAAAGGGATGGAAGAAGG - Intronic
1173941149 20:46912613-46912635 ATGGGGAAAAAGTAAGTAGAGGG + Intronic
1175172729 20:57091570-57091592 ATGGGGAAAGAGATGAGGGAAGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175530694 20:59672741-59672763 ATGAGGAGAGAGATGGTGGAGGG - Intronic
1175589551 20:60177718-60177740 CTGGGGTGACAGGTGGTAGAGGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1176808923 21:13517297-13517319 ATGGGGAAAGAAAAGATAGACGG + Intergenic
1176957403 21:15121813-15121835 GTGGGGAAACAGTTGTTAGAGGG + Intergenic
1177675903 21:24297987-24298009 ATGGGAATACAGATGTCAGAGGG + Intergenic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1179083644 21:38196828-38196850 ATTGGGCAACAGATGGTATTTGG + Intronic
1179276244 21:39894251-39894273 CTGGGGAAGCAGGTAGTAGAGGG - Intronic
1182035752 22:27197021-27197043 ATGGGGAAAAAGAGTCTAGAAGG + Intergenic
1182452212 22:30428395-30428417 ATGAGGGAACAGAAGGCAGAAGG - Intronic
1182711857 22:32328170-32328192 ATGGGGGAACTGAGGGCAGAAGG - Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1183752249 22:39728184-39728206 ATGGGGAAACTGAGGTTTGAAGG - Intergenic
1183948347 22:41339227-41339249 ATGGGGACACAGCGGGGAGAGGG - Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
950264502 3:11564151-11564173 CTGGGGAAATATATGGGAGAAGG - Intronic
953384632 3:42499610-42499632 ATGGGGGAACAGAGAGTAGGAGG + Intronic
954413574 3:50381898-50381920 ATGGGGTAACTGATGGTAGGGGG - Intronic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
956017563 3:64899945-64899967 TTAAGGAGACAGATGGTAGAAGG + Intergenic
956099201 3:65749639-65749661 TTGGGGGAACAGATGGTATTTGG - Intronic
956504046 3:69918653-69918675 ATGAGGAAACTGAGGGCAGAGGG - Intronic
957233315 3:77549870-77549892 ATGGAGAAACAGATCCCAGAGGG + Intronic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958837475 3:99162724-99162746 ATGGGGAAACAAGTGGTGTAGGG - Intergenic
960717372 3:120590060-120590082 ATGGGGGCACAGGTGGTATATGG + Intergenic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961092146 3:124122712-124122734 ATGAGAAAACAGCTGGTAGGTGG - Intronic
961144642 3:124584072-124584094 ATGGGGAAACTGAAGATAAAAGG + Intronic
961620414 3:128219496-128219518 ATGGGGAAACAGCAAGGAGAAGG - Intronic
962074709 3:132069596-132069618 ATGGGGGACCAGAAGGTTGAAGG - Intronic
962410973 3:135141612-135141634 ATGATGAAACAGATGGTAGCAGG - Intronic
963469812 3:145726231-145726253 ATGATGAAAGAGATGGAAGAGGG - Intergenic
964115089 3:153128169-153128191 TTGGGGAAACAGGTGGTATTTGG + Intergenic
964316325 3:155448164-155448186 ACAGTTAAACAGATGGTAGATGG - Intronic
964325485 3:155541529-155541551 ATGGGGAATCAGGTGGTTCATGG + Intronic
964355364 3:155846787-155846809 ATGGGGAGACAGAGGTGAGAAGG - Intronic
964649722 3:158996891-158996913 ATGGGGAAACTAATGGTATAAGG - Intronic
965023136 3:163261165-163261187 AAGTGATAACAGATGGTAGAAGG - Intergenic
965480412 3:169211969-169211991 ATGGGAAAACAGATGGCAGGTGG - Intronic
965613716 3:170571163-170571185 ATGGGAGAACTGATGGCAGAAGG - Intronic
966908162 3:184542676-184542698 AGAGAGAAACAGATGGGAGAAGG + Intronic
968037856 3:195563453-195563475 ATGGGGAGACAGAGGGCAAAAGG - Intergenic
968511332 4:997219-997241 AAGGGGACACAGGTGCTAGAGGG - Intronic
969100278 4:4763299-4763321 ATGGGCAAATAGAAAGTAGAGGG - Intergenic
969510279 4:7613780-7613802 ATTGGTAGACACATGGTAGATGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970969283 4:21962933-21962955 ATGGGCATACTGATTGTAGAGGG + Intergenic
973587119 4:52404565-52404587 ATGGGGAGACAGATGTTCAAGGG - Intergenic
974179392 4:58364186-58364208 ATAGGGCAACAAATGGGAGATGG - Intergenic
975068166 4:70096405-70096427 TTGGGGAAACAGATGGTGTTTGG + Intergenic
975561782 4:75715423-75715445 ATGGACAAAGAGAGGGTAGAAGG - Intronic
976143598 4:82019258-82019280 ATGATGAAAGAGATGGTGGAAGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
977287721 4:95129892-95129914 ATGGTGAAACAGATTGGAAAAGG + Exonic
978580674 4:110228541-110228563 ATGGGGAAGCAGATCCCAGATGG + Intergenic
979314041 4:119238372-119238394 TTGGGGAAACAGATGGTCAGTGG + Intronic
979474020 4:121133811-121133833 ATTTGGACACAGATGGAAGATGG + Intronic
980263520 4:130485228-130485250 TTGGGGGAACAGATGGTATTTGG - Intergenic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
981578316 4:146227713-146227735 ATGGGAAATTAGATGGTGGAGGG + Intronic
982140315 4:152311056-152311078 ATGGGAAAACAGGTTGGAGAGGG + Intergenic
982338969 4:154273570-154273592 TTGGGGAAACAGATGGTCTTTGG - Intronic
982540387 4:156662445-156662467 AAGGGGAAACAATTGCTAGAGGG - Intergenic
982816854 4:159896752-159896774 ATAGGGAAACAGATGGGAAATGG + Intergenic
983630791 4:169847352-169847374 ATGGGGAAAAAAATGGTGAAGGG + Intergenic
984392316 4:179151859-179151881 ATGAGGCAACAGAACGTAGAGGG - Intergenic
985316189 4:188660958-188660980 ATGGGGAGACAGATGCCAGAGGG + Intergenic
986631646 5:9779569-9779591 ATGGGGAAACAGCTGGTCAGTGG + Intergenic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
987242352 5:16013476-16013498 ATGGGGAAACAGCTGGTCAGTGG + Intergenic
987544473 5:19295138-19295160 ATGAGGAAACAGCTGGTACATGG - Intergenic
987753035 5:22066186-22066208 TTGGGGGAACAGGTGGTAGTTGG + Intronic
988724611 5:33913859-33913881 TTGGGGAAACAGGTGGTATTTGG + Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
990036116 5:51322249-51322271 ATGTGGAAATAGACAGTAGAAGG + Intergenic
990594595 5:57300205-57300227 ATGAGGAAACAGAGGTTACATGG - Intergenic
991554991 5:67885899-67885921 TTGGGGACACTGATGGCAGATGG - Intergenic
993441943 5:87967939-87967961 TTGGGGGAACAGATGGTATTTGG - Intergenic
994466988 5:100148747-100148769 ATGGGGAAACAACTGGTTGGTGG + Intergenic
994899656 5:105754909-105754931 ATAAGAAAACAGATCGTAGAGGG - Intergenic
995254642 5:110032498-110032520 ATCTGGAGACAGATGGTGGAGGG + Intergenic
995426162 5:112025859-112025881 ATGGAGAAACAGGTGGTTGGTGG - Intergenic
996549139 5:124711940-124711962 ATGGGAAAACAGATGAGACAGGG + Intronic
997646497 5:135485627-135485649 ATGGGGAAACAGACCCTAGGAGG - Intergenic
998506617 5:142677633-142677655 AAGGGACAACAGAGGGTAGAAGG + Intronic
999773486 5:154792906-154792928 ATGGGGAAACTGATGGATGTAGG + Intronic
999924349 5:156358896-156358918 GTGGGGAGACAGGTGGGAGAGGG + Intronic
1001061348 5:168492144-168492166 ATGGGAAAACAGGAGGTAGTAGG + Intronic
1001184893 5:169560988-169561010 TTTGGGAAAACGATGGTAGAGGG + Intergenic
1001332669 5:170773212-170773234 ATGGGGGCACGGATGGGAGAAGG + Intronic
1001500008 5:172224108-172224130 ATGAGGCAACAGAAGATAGATGG + Intronic
1002132862 5:177092100-177092122 ATGGGGAGCCAGGTGGTGGAGGG + Intronic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003782379 6:9443981-9444003 AAGGGGTAACAGATGGCAAATGG + Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004378752 6:15114380-15114402 AAGGACACACAGATGGTAGATGG + Intergenic
1004842311 6:19601117-19601139 ATGGGGAAAAAAATGTTAGTAGG + Intergenic
1005070921 6:21861568-21861590 ATGGTGGAAGAGATGGAAGAGGG + Intergenic
1005718385 6:28575808-28575830 ATGGGGAAACAGATAAAATACGG - Exonic
1005809683 6:29506345-29506367 ATGGGGGAAGAGATGGAAAAAGG - Intergenic
1006016429 6:31084959-31084981 ATGCGGAAAGAGATTGTTGAGGG - Intergenic
1006677066 6:35771935-35771957 TTGGGGATACAGATTGGAGATGG - Intergenic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007552744 6:42742743-42742765 AGGCTGAAACAGATGGTGGAGGG + Intergenic
1007599473 6:43072864-43072886 TTGGGGAGAGTGATGGTAGAAGG + Exonic
1007945410 6:45822348-45822370 ATCAGGAAACAGATGGTAATGGG + Intergenic
1008784396 6:55148498-55148520 ATGGAGAAGCACATGGTAGGTGG - Intronic
1008856753 6:56097416-56097438 TTGGGGAGATAGATGGTAAAAGG - Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009879922 6:69554099-69554121 ATGGTTTAACAGATGGCAGATGG - Intergenic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011326313 6:86152541-86152563 ATGGGGAACCAAATGGCAGATGG + Intergenic
1012547859 6:100440239-100440261 ATGGGGCAACAGAGGGTCAAAGG + Intronic
1013176175 6:107679013-107679035 ATAAGTAAGCAGATGGTAGATGG - Intergenic
1013618846 6:111870233-111870255 AAGGGGCAACAGAGAGTAGACGG - Intronic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016515781 6:144891896-144891918 AGGGGGAAACAGAGGGCAAAGGG + Intergenic
1017278220 6:152594685-152594707 GTTGGGAAACTGATGGTAGCTGG - Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1020565591 7:9790676-9790698 ATGGGGAATAACATGTTAGAGGG - Intergenic
1021386606 7:20038799-20038821 ATTTCAAAACAGATGGTAGAAGG + Intergenic
1022309005 7:29177621-29177643 ATAGATAAACAGATGGAAGAAGG - Intronic
1022998564 7:35784235-35784257 TTGGGGGAACAGATGGTATTTGG - Intergenic
1023194837 7:37623661-37623683 ATGGGAGAATAGATTGTAGAGGG + Intergenic
1024201916 7:47116837-47116859 ATGGGGCAGCAGTTGGCAGAAGG - Intergenic
1026153005 7:67803875-67803897 AGGAGGAGACAGAAGGTAGAAGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1028354058 7:89885316-89885338 GTGGGGACACTGAGGGTAGATGG - Intergenic
1028520691 7:91727154-91727176 ATGGGTATACAAATGATAGAAGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1030483688 7:110138411-110138433 ATGGGGAAACTGCTGGTCAATGG - Intergenic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1030625346 7:111839852-111839874 TTGGGGAAACAGGTGGTATTTGG + Intronic
1031281757 7:119811735-119811757 ATGGGGAAACAGCTGGTCACTGG + Intergenic
1032259058 7:130319967-130319989 ATGGGGAACAAGAAGTTAGAGGG + Intronic
1033241594 7:139684227-139684249 ATGGGGGAACAGCTCATAGATGG - Intronic
1033966882 7:146986026-146986048 ATTGGGAAACAGGTGGTATTTGG + Intronic
1034764135 7:153701792-153701814 ATAGGTAGACAGATGATAGATGG + Intergenic
1034821227 7:154218087-154218109 ATGGGGGAAACGATGGTGGATGG - Intronic
1036126720 8:6069787-6069809 ATGAGGACACAGCTGGGAGATGG - Intergenic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1037533694 8:19805290-19805312 ATTGGAATAGAGATGGTAGATGG + Intergenic
1037860401 8:22401033-22401055 ATGAGAAAACTGAAGGTAGAGGG + Intronic
1042578226 8:70246353-70246375 GTGGGGAAAAAGATGGTGTAAGG + Intronic
1042730152 8:71924282-71924304 ATGGGGAAACCCATGGGGGAAGG + Intronic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1043097902 8:75999191-75999213 ATGGGGAAAGACAAGGTGGAAGG - Intergenic
1043278803 8:78436944-78436966 TTGGGGAAACAGGTGGTATTTGG - Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044375401 8:91464309-91464331 TTGGGGGAACAGGTGGTAGTTGG + Intergenic
1044657364 8:94562449-94562471 ATGGGGAAAGAGAGAGTATATGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045541954 8:103094917-103094939 ATGGGGAAACAGCTGGTTGGTGG + Intergenic
1046174683 8:110560050-110560072 ATGGGGAGCCAGAAGGTGGAGGG + Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048529616 8:135235477-135235499 ATGGGGGCACAGTTGGTACAGGG - Intergenic
1049243050 8:141548505-141548527 ATGGGGTGACAGCTGGCAGAGGG - Intergenic
1050265109 9:3881668-3881690 ATGGGTGAACAGATGGATGATGG - Intronic
1050859443 9:10407923-10407945 ATGGGGAAACTTTTGGAAGAAGG + Intronic
1051035243 9:12736781-12736803 ACAGGAAAACAGATGTTAGATGG - Intergenic
1051201077 9:14624663-14624685 ATGGGGAAGAGGATGGTCGATGG + Intronic
1051698338 9:19792386-19792408 AAGGTGAAAGAGATGGTTGAGGG + Intergenic
1051875104 9:21784586-21784608 ATGGGAAAAGAGATGGTAAGGGG - Intergenic
1052032380 9:23643454-23643476 ATGGTTAAACTGGTGGTAGAAGG + Intergenic
1052330505 9:27262589-27262611 ATGAGAAAACAGAGGGTAGGAGG + Intergenic
1053355961 9:37445738-37445760 ATGGGGAAAAGGATGGGACAGGG + Intronic
1053385406 9:37683454-37683476 ATGAGAAAACAGACTGTAGAGGG + Intronic
1054851104 9:69847686-69847708 AAGGGGAAACAGATGGGAATAGG - Intronic
1055912380 9:81367430-81367452 ATTGGGAAACAGGTGGTATTTGG - Intergenic
1056093797 9:83230764-83230786 ATGGGGGAACAGCTGGCAGCTGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1057627455 9:96690347-96690369 ATGGGAAAACAGGAGGTAGTAGG - Intergenic
1057899957 9:98940999-98941021 ATGGGTAAACAGAAGATATATGG - Intergenic
1057934553 9:99226071-99226093 ATGGGAAAACTGATTGTAAATGG - Intronic
1059354504 9:113688197-113688219 AAGAGGAAACAGATCGGAGAGGG - Intergenic
1059419143 9:114180360-114180382 ATGGGGAAACTGAGCCTAGAAGG - Intronic
1059449596 9:114362158-114362180 ATGGGGAAACTGAGGCTAGATGG - Intronic
1059813020 9:117877422-117877444 ATTGGGAAACAGGTGGTATTTGG - Intergenic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061613445 9:131763624-131763646 ATGGGCAGACAGAGGGCAGAGGG + Intergenic
1185498679 X:580688-580710 ATGGATAAATAGATGATAGATGG + Intergenic
1185498683 X:580749-580771 ATGGATAAATAGATGATAGATGG + Intergenic
1185498692 X:580892-580914 ATGGATAAATAGATGATAGACGG + Intergenic
1185498701 X:581035-581057 ATGGATAAATAGATGATAGACGG + Intergenic
1185498708 X:581152-581174 ATGGATAAATAGATGATAGATGG + Intergenic
1185694013 X:2180602-2180624 ATAGGCAGACAGATGATAGATGG - Intergenic
1185809404 X:3091783-3091805 ATAGGTAAATAGATGATAGATGG + Intronic
1185949687 X:4418947-4418969 ATTGGGGAACAGATGGTATTTGG - Intergenic
1186304092 X:8235363-8235385 ATAGGGTAACAGCTGGTAGGTGG + Intergenic
1187186814 X:16994778-16994800 TTGGGGGAACAGATGGTATTTGG - Intronic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1188481225 X:30638796-30638818 AAGTGTAAACTGATGGTAGAAGG - Intergenic
1188540550 X:31245801-31245823 ATGGGGGAACAGCTGGTCGGTGG - Intronic
1189042823 X:37560750-37560772 AAGGGGTAACAGATGGCACATGG + Intronic
1189110763 X:38286584-38286606 AGGAGGAAACAGAGGGGAGAGGG - Exonic
1189523555 X:41796225-41796247 ATGAGGAAACAGATGTTCTAAGG - Intronic
1190147813 X:47912932-47912954 ATGGGGAAACAGATTCTAGTGGG + Intronic
1190318466 X:49165716-49165738 ATGGGGATCCAGAGGGTAGGGGG + Intronic
1192301928 X:69913902-69913924 ATGGGGGAACAGCTGGTTGTTGG + Intronic
1193333404 X:80260493-80260515 ATGGGGACAGAGATGTCAGAAGG - Intergenic
1194641327 X:96406944-96406966 ATGGGGGACCACAGGGTAGAGGG - Intergenic
1194742113 X:97586100-97586122 TTTGGGTAATAGATGGTAGATGG - Intronic
1194852098 X:98881957-98881979 ATGGAGAAACTGATGGAAGTAGG + Intergenic
1195076768 X:101334825-101334847 ATCGGGAAACAGGTGGTATTTGG - Intergenic
1195303348 X:103554476-103554498 ATTGGGAGACAGATGGGAAAAGG - Intergenic
1198617003 X:138469310-138469332 ATTGGGAAACAGATGGTGTTTGG - Intergenic
1199465556 X:148132086-148132108 ATTGGGAAACAGATGGTGTTTGG - Intergenic
1200250115 X:154548263-154548285 ATGGGGAACCCGATGGTACAGGG + Intronic
1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic