ID: 1118054500

View in Genome Browser
Species Human (GRCh38)
Location 14:62065541-62065563
Sequence GCAATTATTAATTTTATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 555}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118054499_1118054500 -2 Left 1118054499 14:62065520-62065542 CCATATACTAATAAATTAGTTGC 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1118054500 14:62065541-62065563 GCAATTATTAATTTTATAGATGG 0: 1
1: 0
2: 4
3: 57
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118054500 Original CRISPR GCAATTATTAATTTTATAGA TGG Intronic
900012356 1:127549-127571 GCAATTATTCATTGAATAAATGG - Intergenic
900042414 1:483533-483555 GCAATTATTCATTGAATAAATGG - Intergenic
900063854 1:718526-718548 GCAATTATTCATTGAATAAATGG - Intergenic
901097454 1:6693687-6693709 TTTATTATTATTTTTATAGACGG + Intronic
901131999 1:6967712-6967734 GCAATTGTGCATTTCATAGATGG + Intronic
901421168 1:9152104-9152126 CCAATTTTTATTTTTAGAGACGG - Intergenic
904569663 1:31453578-31453600 GCAATTTTTACTTCTATAGAAGG + Intergenic
904571777 1:31471420-31471442 GTAATTTTTACTTCTATAGAAGG + Intergenic
904748085 1:32723674-32723696 TCATTTATTTATTTTAGAGATGG - Intergenic
905192960 1:36250142-36250164 AAAATTATTAATTTTAGAGTTGG - Intronic
905410034 1:37762238-37762260 CCAATCCTTATTTTTATAGATGG + Intronic
905969177 1:42128156-42128178 GCAATATTTAATATTATAGGAGG + Intergenic
907054318 1:51350912-51350934 GCAATTATTATTTTTATTTTTGG + Intergenic
907142428 1:52200489-52200511 GAAATTTTTAATTTTAGTGAAGG + Intronic
908305590 1:62812402-62812424 GCAGTTTTGAATTTTATCGAAGG - Intronic
908343169 1:63203699-63203721 GTAATTTTTATTTCTATAGATGG + Intergenic
908431721 1:64065007-64065029 GCACTTTTTAATTGTGTAGAGGG + Intronic
909256784 1:73434234-73434256 ACATTTACTATTTTTATAGATGG + Intergenic
909522975 1:76590613-76590635 AAAATTATTAATTTTAAATATGG - Intronic
909545502 1:76842149-76842171 CCAATTTTTATTTTTAAAGAGGG + Intergenic
909742752 1:79052299-79052321 GAAAGTATTAATTTTATTCATGG + Intergenic
910266926 1:85347786-85347808 CCCATTATTAATTTTATTGATGG + Intronic
911254527 1:95618835-95618857 GTAATTATTTAATTCATAGATGG - Intergenic
911551302 1:99284315-99284337 GAAATAAATAATTTTATACATGG - Intronic
911791917 1:102028030-102028052 TCAATCATTTATTTAATAGATGG + Intergenic
911851435 1:102826472-102826494 TCAATTTTTACTTCTATAGAAGG - Intergenic
912176511 1:107164830-107164852 GCAATTTTTACTTCTATAGAAGG + Intronic
912329040 1:108800175-108800197 GCAATTTACAATTTTATTGATGG + Intronic
913355836 1:117921234-117921256 GCAAATATTTTTTTTTTAGACGG - Intronic
915001245 1:152594852-152594874 GCAATTATTAAATTTTCTGAAGG - Intronic
915235834 1:154480907-154480929 GCAAGTATTTTTTTTAAAGAAGG + Exonic
915387413 1:155508336-155508358 CTCATTATTAATTTTATAGCAGG - Intronic
915716940 1:157953650-157953672 GCATTTATTATTTTTCTAGTAGG + Intergenic
915833798 1:159156841-159156863 GCAATTATAATTTTTCTTGAAGG + Intergenic
916225399 1:162485002-162485024 GTAATTATTAGTTTTAGATAGGG + Intergenic
916503068 1:165403503-165403525 GCAATTTCTACTTTTTTAGATGG - Intronic
917118752 1:171627531-171627553 GCACTTTTTACTTTTAAAGAAGG - Intergenic
917145008 1:171881063-171881085 TAAATTATTTATTTTATTGAAGG + Intronic
918199623 1:182255044-182255066 GTAATTATTATCTTTTTAGATGG - Intergenic
919468363 1:197949162-197949184 GCAATGATTATTTTCATACATGG + Intergenic
920143185 1:203835198-203835220 GCAAATATTAATTTCATTCATGG - Intronic
920392567 1:205618486-205618508 CCAAATATTAATTTTCTAGCTGG - Intronic
921919615 1:220652389-220652411 GCAATTTTTAACTTTATAGACGG - Intronic
922045352 1:221940019-221940041 GCAAGTGTGTATTTTATAGATGG - Intergenic
922260786 1:223944017-223944039 GCAATTATTCATTGAATAAATGG - Intergenic
922736283 1:227981714-227981736 GCAATTATTCATTGAATAAATGG + Intergenic
922903122 1:229153769-229153791 GCAATTAATAATTCTATTAATGG - Intergenic
923447966 1:234090056-234090078 GCAATGATAAATTTTAAACAAGG + Intronic
923587239 1:235284650-235284672 CCAAATTTTAATTTTAGAGATGG - Intronic
923814051 1:237355181-237355203 CCAATTATACATTCTATAGATGG + Intronic
924080786 1:240395507-240395529 GGAATTATGAATGTTATTGATGG - Intronic
924091910 1:240510045-240510067 GCGATAATTATTTTTATAAATGG - Intronic
924341962 1:243046203-243046225 GCAATTATTCATTGAATAAATGG - Intergenic
924374856 1:243395003-243395025 GAAATCATTACTTTTATAAATGG - Intronic
924426005 1:243950920-243950942 GCAATGAATAATCTTATAGCAGG + Intergenic
924481418 1:244438681-244438703 GTATTTTTTAATGTTATAGAAGG - Intronic
924646641 1:245883993-245884015 TCAAATATTAAATTTATACAGGG + Intronic
1063140216 10:3250130-3250152 CCAAATATTCATTTTATACATGG - Intergenic
1063420093 10:5905511-5905533 GTATTTATTTATTTTTTAGATGG - Intronic
1063499334 10:6538792-6538814 TCATTTATTTATTTTGTAGATGG + Intronic
1063741564 10:8827699-8827721 GAAATTATTAATATTATCTAGGG + Intergenic
1063997950 10:11638855-11638877 TCTATTTTTTATTTTATAGATGG - Intergenic
1064247544 10:13681011-13681033 TCAATTGGTAATTTTATAGATGG - Intronic
1064808943 10:19171153-19171175 GAAATTATTTTTTTCATAGAAGG + Intronic
1064986786 10:21218274-21218296 GCAAACATTACTTTTATCGATGG - Intergenic
1065302010 10:24331292-24331314 GCAATATTTAATTTTGGAGAGGG - Intronic
1066734519 10:38459336-38459358 GCAATTATTCATTGAATAAATGG + Intergenic
1066982498 10:42431433-42431455 GTAATTATTAGTTTTAGAAACGG + Intergenic
1067765979 10:49087173-49087195 GCAATTAAGAACTTAATAGAAGG - Intronic
1068020774 10:51581062-51581084 GCATTTATTAAGTTTAGTGAGGG + Intronic
1068276098 10:54799142-54799164 GTAATTATTATTTTTATCAAAGG - Intronic
1068914332 10:62412217-62412239 GCAATGTTGAATTTTATTGAAGG - Intronic
1069090986 10:64198032-64198054 TCAATTCTTAATTTTATAAATGG - Intergenic
1069199629 10:65596844-65596866 GGAAATATTTATTTTATATATGG - Intergenic
1069262257 10:66413570-66413592 TTAACTATTAATTTTATAGTTGG + Intronic
1070598600 10:77849852-77849874 GAAAATATTATTTTTTTAGAAGG - Intronic
1070824524 10:79382991-79383013 GGTTTTATTAATTTTGTAGAGGG - Exonic
1071479283 10:86052284-86052306 TATATTATTAATTTTTTAGAGGG - Intronic
1071773514 10:88757571-88757593 GCCATTATTGTTTTTAAAGATGG + Intergenic
1072073987 10:91949963-91949985 TTAATTTTTAATTTTAGAGATGG - Intronic
1072344868 10:94494865-94494887 GTATTTATTTATTTTAGAGACGG + Intronic
1073621623 10:105055579-105055601 TTTATTATTAATTTTATAGCTGG - Intronic
1074588554 10:114791075-114791097 TCATTTATTTATTTTACAGATGG + Intergenic
1074727619 10:116328950-116328972 CCAATATTTAATTTTATAGTTGG + Intronic
1074997450 10:118770101-118770123 GCAATTTTTACTTCTACAGAAGG - Intergenic
1075213226 10:120509493-120509515 ACAATTAGTAACTTTAAAGATGG + Intronic
1076360620 10:129886327-129886349 GCAATTATTAGTTTTAATGCAGG + Intronic
1076968686 11:119753-119775 GCAATTATTCATTGAATAAATGG - Intergenic
1077763072 11:5124803-5124825 GCATTAATTAATTTTAAATAAGG - Intergenic
1077833473 11:5901350-5901372 GCCAGTATTAATGTTATATATGG + Exonic
1078377922 11:10811591-10811613 TTAATTTTTAATTTTAGAGATGG - Intergenic
1079457480 11:20649575-20649597 ACAAATATCCATTTTATAGAAGG - Intronic
1080614186 11:33931918-33931940 GCAATTTTTACTTCTATAGAAGG + Intergenic
1080676871 11:34435961-34435983 GCAATTATTCATATTAAAGCGGG + Intergenic
1081024920 11:37999334-37999356 GCAATTATTAATCGTATATGTGG - Intergenic
1081258003 11:40921325-40921347 GTCATTATTAATTTTTAAGATGG + Intronic
1081954688 11:47080448-47080470 GAAATTATTATTTTTTGAGACGG - Intronic
1082124953 11:48421731-48421753 AAAATTATTAATTATATCGAGGG + Intergenic
1082251093 11:49980990-49981012 AAAATTATTAATTATATCGAGGG - Intergenic
1082558615 11:54592970-54592992 AAAATTATTAATTATATCGAGGG + Intergenic
1082649181 11:55766856-55766878 GCAATTATTAAAAATATAAATGG + Intergenic
1084829583 11:71758703-71758725 ACATTTATTTATTTTAGAGATGG - Intergenic
1086059544 11:82686215-82686237 GCTAATATATATTTTATAGATGG - Intergenic
1087521366 11:99241042-99241064 TCAATGAATAATCTTATAGAAGG + Intronic
1087715119 11:101599682-101599704 GCAATTTTTCCTTTTAAAGATGG + Intronic
1087819359 11:102694080-102694102 GTGATTATTTATTTTCTAGAGGG + Intronic
1088060616 11:105644904-105644926 GCAAGTAATAAGTTTCTAGAAGG + Intronic
1088623389 11:111709621-111709643 GCAAATATTAAATAAATAGATGG - Intronic
1089060471 11:115622214-115622236 ACAATTATTATTATTGTAGAAGG - Intergenic
1089719861 11:120405830-120405852 GCAATTGCTAAATTTATAAAGGG - Intronic
1090005248 11:122996691-122996713 GAAAGTATCACTTTTATAGAGGG + Intergenic
1090426042 11:126607726-126607748 GCAATTAGCCATTTTACAGATGG + Intronic
1092709259 12:11317391-11317413 GGATTTATTAATTTTTTTGAAGG - Intergenic
1092878709 12:12871207-12871229 GCTATTATTAGTATTATACAGGG + Intergenic
1093276203 12:17130999-17131021 GAAATAATTAATATTAAAGAGGG + Intergenic
1093408244 12:18832819-18832841 GGAATTTTGAATTTTATTGAAGG - Intergenic
1094095499 12:26699782-26699804 GCTATTATTCAATTTAGAGATGG - Intronic
1094206682 12:27847795-27847817 GCAATATTGAATTTTATCGAAGG + Intergenic
1094335684 12:29349102-29349124 GCAATTATTAATCCTTTAGATGG - Exonic
1094385272 12:29886923-29886945 ACAATAATTAATTTTTTAAAAGG + Intergenic
1095238132 12:39823617-39823639 GATATTATTATTATTATAGACGG + Intronic
1095438067 12:42213466-42213488 GAAATTATTTACTTTAGAGATGG - Intronic
1095655632 12:44666673-44666695 CTAACTATTTATTTTATAGAGGG + Intronic
1096472049 12:51885103-51885125 GCAATTTTTACTTCTATAGAAGG - Intergenic
1097153919 12:56999009-56999031 GTACTTATTAATTTAATGGAAGG + Exonic
1097497745 12:60363332-60363354 GCAAATATAAATTTTAAAAAGGG - Intergenic
1097519688 12:60651890-60651912 GTAATTTTTACTTCTATAGAAGG + Intergenic
1097844899 12:64356376-64356398 GCAATTTTTACTTCCATAGAAGG + Intronic
1097936524 12:65258172-65258194 GCAATTAATAAGATTATAGAGGG + Intergenic
1097955153 12:65477426-65477448 GCAATTATTCATTGTTGAGATGG + Intronic
1098830353 12:75353921-75353943 GGAATGATGAATTTTATTGAAGG - Intronic
1099098336 12:78404139-78404161 GCAATTTTAAATTTTCTAGTAGG - Intergenic
1099447567 12:82770122-82770144 GCAGTTATACATTTTATAAAGGG - Intronic
1100860044 12:98795202-98795224 CCCTTTATTAATGTTATAGAAGG + Intronic
1101778889 12:107817915-107817937 GCAATTTTTACTTCTATAGAAGG + Intergenic
1102735650 12:115156943-115156965 GGAATTATCAATTTTAGTGAGGG + Intergenic
1102753816 12:115320670-115320692 GCATTTATTAATTTCAAAGTAGG + Intergenic
1102998670 12:117368537-117368559 CCACTTCTTAATTTTATACATGG - Intronic
1104691704 12:130831220-130831242 ACAATTATTATTTGTATGGAAGG - Intronic
1105460396 13:20579949-20579971 GCATTTCTTAATTTTATAATTGG - Intronic
1106157716 13:27172748-27172770 GCAAATATGAATTTTATAAAAGG - Intergenic
1106222128 13:27754987-27755009 GCAATTTTTACTTCTATGGAAGG - Intergenic
1107432628 13:40353382-40353404 GCAAATATGACTTTTATCGATGG - Intergenic
1108474811 13:50804038-50804060 TCCAATATTAATTTTTTAGAGGG + Intronic
1108885984 13:55182402-55182424 CCAATTTTCAATTTTATAGAGGG + Intergenic
1109126583 13:58525986-58526008 TCTATTATTTATTTTTTAGATGG + Intergenic
1109235418 13:59812328-59812350 GTAAGTATTAATTGGATAGATGG - Intronic
1109615194 13:64825868-64825890 GTAATTATTATTTTTTGAGATGG + Intergenic
1109726037 13:66343113-66343135 GTAACTATTATTTTTATTGATGG - Intronic
1109910152 13:68898757-68898779 GCAATTTTCACTTCTATAGAAGG - Intergenic
1109993468 13:70089589-70089611 GTATATATAAATTTTATAGATGG + Intronic
1110084539 13:71361588-71361610 TTTATTATTAATTTTATAAAAGG - Intergenic
1110146363 13:72195777-72195799 GCATTTATTCATTTTATAATAGG + Intergenic
1110983848 13:81938763-81938785 GCAATGTTGAATTTTATAAAAGG + Intergenic
1111203008 13:84963353-84963375 GGAATTAGTAAATTTGTAGAAGG - Intergenic
1111236543 13:85416927-85416949 GGAAGTAATAATTTTATTGATGG + Intergenic
1111905009 13:94245233-94245255 TCATTTATTTATTTTTTAGATGG + Intronic
1112391168 13:98985637-98985659 TCAATAATTTATTTTAGAGATGG + Intronic
1112862474 13:103849625-103849647 TCAAATATTAATATTGTAGATGG + Intergenic
1113109456 13:106806806-106806828 GCAATTATTTCTTTTGGAGATGG + Intergenic
1113765076 13:112876226-112876248 GTAATGATTAATTTTAAAAAAGG - Intronic
1113978385 13:114250006-114250028 TGAATTGTTAATTTTATATAAGG - Intronic
1114382668 14:22224468-22224490 GCTATGATTTATTTTATAGCAGG + Intergenic
1114382724 14:22225041-22225063 TCAAATAATAATTCTATAGAAGG + Intergenic
1115110385 14:29814235-29814257 GCAATGATTAATTATGTAGTGGG - Intronic
1115226973 14:31113186-31113208 TTATTAATTAATTTTATAGATGG - Exonic
1115541559 14:34425923-34425945 ACAATTTTTACTTCTATAGAAGG - Intronic
1115908606 14:38230246-38230268 GCAATAGTTAATTTTAAAAAGGG - Intergenic
1116302432 14:43201844-43201866 GAAATTATTGATTTTCTAAATGG - Intergenic
1116363200 14:44027699-44027721 GCAATCATTAAGTTTAAATAAGG - Intergenic
1116396003 14:44449504-44449526 GCAATTTTTACTTCTATAGAAGG + Intergenic
1116522384 14:45865872-45865894 AGAATTATTTATTTTATTGATGG + Intergenic
1117806481 14:59497279-59497301 GCAGTTATTACTCTTATAGCAGG + Intronic
1117897758 14:60506356-60506378 GCTTTTCTTAATTTTACAGAAGG - Intronic
1118054500 14:62065541-62065563 GCAATTATTAATTTTATAGATGG + Intronic
1118535666 14:66761380-66761402 CCCTTTATTAATATTATAGAAGG + Intronic
1118538485 14:66795657-66795679 GCAATTATTCATATTAGAAATGG - Intronic
1118871510 14:69746903-69746925 GCAAAAATTAATTTTAAAAATGG - Intronic
1119508798 14:75195364-75195386 GCATTTATTATTATTATAGGTGG + Intergenic
1120281433 14:82443542-82443564 TCAATTAATAAATTTGTAGATGG - Intergenic
1124082394 15:26513613-26513635 GCAATAATTTACATTATAGAAGG + Intergenic
1124134016 15:27018130-27018152 TCAAATATTCAGTTTATAGATGG + Intronic
1124467926 15:29956110-29956132 GCATTTTTTAATTTTAGAAATGG - Intronic
1125986098 15:44053821-44053843 ATAGTTACTAATTTTATAGATGG + Intronic
1127146181 15:56026541-56026563 CCAATTACTAAATTTAAAGATGG - Intergenic
1128004292 15:64224302-64224324 GCAATTATTATTATAATACATGG + Intronic
1128039397 15:64557491-64557513 GCAATGAATAATTCTATCGAGGG + Intronic
1128857138 15:71028155-71028177 GCGATGTTTAATTTTATCGAAGG + Intronic
1130895625 15:88168429-88168451 GCAATTATTAATATTCTAAGTGG + Intronic
1132035480 15:98480336-98480358 ACAATTAGTTATTTTTTAGAGGG + Intronic
1133808588 16:9144217-9144239 GCAAGTGGTAATTTTATAAAAGG + Intergenic
1134145219 16:11755329-11755351 GCATTTATTTATTTTATAATAGG + Intronic
1135665866 16:24335116-24335138 CCAATAAATACTTTTATAGAAGG - Intronic
1136633431 16:31503354-31503376 GCCATTATTCATTTTTTAGATGG - Intronic
1137009284 16:35307550-35307572 GCAAACATTTATTTTATTGATGG + Intergenic
1137366970 16:47868940-47868962 TCAATCCTTAATTTTGTAGAGGG - Intergenic
1137749445 16:50848441-50848463 GAAAGTATTATTTTTAGAGATGG - Intergenic
1138004135 16:53314922-53314944 CCAGTTATTAATCTTAAAGATGG + Exonic
1138189900 16:55006328-55006350 GCCATTATTATTTTTAATGATGG + Intergenic
1138375754 16:56563034-56563056 GCAAGTATTAATGGTTTAGAGGG - Intergenic
1138976698 16:62216338-62216360 GCAATGTTGAATTTTATCGAAGG + Intergenic
1139259135 16:65575413-65575435 GCAATTTTTTTTTTTTTAGATGG - Intergenic
1142451989 16:90179369-90179391 GCAATTATTCATTGAATAAATGG + Intergenic
1143396165 17:6599277-6599299 GCAAATATTCATTTGAAAGATGG - Exonic
1143577440 17:7802666-7802688 GCAATTTTTTTTTTTTTAGACGG + Intronic
1144163113 17:12581262-12581284 GCCATTATTAATGATAAAGAAGG - Intergenic
1144345963 17:14350002-14350024 GCAAATACTAATTGTACAGATGG - Intergenic
1145009670 17:19360740-19360762 GCAATCATTGCTTTTATGGAGGG - Intronic
1146120988 17:30194670-30194692 GCATTTACTAATTTTTTAAATGG - Exonic
1147789659 17:43005827-43005849 GCAATTATTATTTTTTGAGATGG + Intergenic
1148292892 17:46471918-46471940 GTAATTCTCAATTTGATAGATGG - Intergenic
1148315076 17:46689615-46689637 GTAATTCTCAATTTGATAGATGG - Intronic
1149683859 17:58523981-58524003 GAAATTATTAGTATTATGGAAGG + Intronic
1150021350 17:61616933-61616955 AGAATTATCAATTTTAAAGATGG + Intergenic
1150572280 17:66397422-66397444 GAATTTATTAATTTGTTAGATGG + Intronic
1152974300 18:198784-198806 GAATTTTTTAATTTTATAAAAGG + Intronic
1153081840 18:1236553-1236575 GAAGTTAATAATTTAATAGAGGG - Intergenic
1153084363 18:1266991-1267013 TCAATCTCTAATTTTATAGAAGG - Intergenic
1153224614 18:2889581-2889603 ACAATTATTAATTTTTAATAAGG - Intronic
1153462181 18:5348132-5348154 GCAATATTTAATTTTATCAAAGG - Intergenic
1155275156 18:24180360-24180382 GCACTTTTTAATGTTTTAGATGG - Intronic
1155530145 18:26758656-26758678 GCAATTCTGCATTTTAAAGAGGG - Intergenic
1155690257 18:28612805-28612827 GTAATTATTCACTTTATATAGGG + Intergenic
1155748247 18:29388244-29388266 GCAATATTTTATTTTATAGGGGG - Intergenic
1155934304 18:31739319-31739341 GCAATTTTTACTTCTATAGAAGG - Intergenic
1156784194 18:40891302-40891324 TCAATTTTTAATTTTCTTGAAGG - Intergenic
1158808917 18:61008111-61008133 GCAATTTGCAAATTTATAGAAGG + Intergenic
1158964067 18:62608414-62608436 GCCAATATCAATTCTATAGACGG + Intergenic
1159453937 18:68637862-68637884 TCAATTATTAATTTAATCAAGGG - Intergenic
1159613851 18:70556587-70556609 GCAAGTATTCATATTGTAGATGG + Intergenic
1159842491 18:73415802-73415824 GCAATTATAAATATTTTAGCAGG - Intergenic
1160162992 18:76489969-76489991 GGGATTATTATTTTTTTAGAAGG + Intronic
1160645495 19:189680-189702 GCAATTATTCATTGAATAAATGG - Intergenic
1160759230 19:774494-774516 GCAATTTTTTTTTTTTTAGATGG + Intergenic
1162772549 19:12957844-12957866 TTATTTATTAATTTTTTAGACGG - Intergenic
1162893320 19:13749399-13749421 GCCAATATAAATTTTATTGATGG - Intronic
1163077968 19:14912790-14912812 GCAATTTTTACTTCTATAAAAGG + Intergenic
1163493710 19:17632344-17632366 CCATTCATTAATTTTAGAGATGG + Intronic
1163836478 19:19577851-19577873 TTAATTATTATTTTTTTAGATGG - Intronic
1164242039 19:23397745-23397767 ACAATATTTACTTTTATAGAAGG - Intergenic
1166780320 19:45338904-45338926 GCATTTATTTATTTTTGAGATGG + Intronic
1168210601 19:54887300-54887322 GAATTTATTTATTTTAGAGAGGG - Intronic
925217463 2:2109719-2109741 TCAATTAAGAATTTAATAGATGG + Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
927074296 2:19561704-19561726 GCCATGATTAATTTTATAAGAGG - Intergenic
927339776 2:21969714-21969736 GCAATAATTAAAATTAAAGAAGG + Intergenic
927499507 2:23573271-23573293 GCATTTATTTATTTTATTTAAGG + Intronic
930174262 2:48285405-48285427 GCAATTTTTACTTCTATAGAAGG - Intergenic
930200336 2:48546732-48546754 AGAATTATTATTTTTAGAGATGG + Intronic
930312753 2:49762460-49762482 GCAATTATTTACTTAATAAATGG - Intergenic
930657511 2:54020968-54020990 GCAATTTTTACTTCTATAGAAGG + Intronic
930936240 2:56955436-56955458 GCAATTTTTACTTCTATAGAAGG - Intergenic
931344367 2:61432606-61432628 GCATTTAAAAATTTTAAAGATGG - Intronic
932135419 2:69224808-69224830 GCAAATATTAATATTTTAGGAGG - Intronic
932968292 2:76504798-76504820 GTAATTATTAATTTTAAAAATGG + Intergenic
933384622 2:81594158-81594180 TCAATTTTTTATTTTAAAGAAGG + Intergenic
933913436 2:86964427-86964449 AAAATGATTAATTTTAGAGAAGG + Intronic
934009558 2:87805471-87805493 AAAATGATTAATTTTAGAGAAGG - Intronic
935264774 2:101384854-101384876 TTATTTATTTATTTTATAGATGG - Intronic
935357299 2:102214515-102214537 GCATTTTATCATTTTATAGATGG + Intronic
935436393 2:103039148-103039170 GTAAGTATTTATTTTATAAAAGG + Intergenic
935773138 2:106446170-106446192 AAAATGATTAATTTTAGAGAAGG - Intronic
935906930 2:107849762-107849784 AAAATGATTAATTTTAGAGAAGG + Intronic
936624908 2:114138299-114138321 GCACTTATAAATATGATAGAAGG - Intergenic
936699855 2:114998437-114998459 GCAAGTAATAATTTTTTAAAAGG + Intronic
937709162 2:124959234-124959256 AAAATTATAAAATTTATAGAAGG + Intergenic
937882012 2:126875442-126875464 GCAATTTTTACTTCTATAGAAGG - Intergenic
938049305 2:128152687-128152709 AAAATTATTAACTTTATAAATGG - Intronic
938090646 2:128431573-128431595 GCAAACATTAATTTTTTAAAGGG - Intergenic
938627816 2:133130521-133130543 AAAATTACTACTTTTATAGAAGG + Intronic
939483866 2:142783862-142783884 ACAATTATTTATTTTCTTGATGG + Intergenic
939538019 2:143456977-143456999 GCATTTATTAATTTAACAGATGG + Intronic
939994092 2:148903888-148903910 CCAAATCTTCATTTTATAGATGG - Intronic
941108274 2:161387656-161387678 GCAAGTGTATATTTTATAGATGG + Intronic
941113693 2:161447079-161447101 GCACATATTAATATTTTAGAGGG + Intronic
941147470 2:161868096-161868118 GCAACTTTTAAATTTATAGTTGG - Intronic
941224976 2:162837781-162837803 TCAATTTTTAAATTTCTAGATGG + Intronic
941477792 2:165970061-165970083 GCAATTATTCTATTTTTAGATGG + Intergenic
942425261 2:175853448-175853470 GCAATTATTAGTTAGACAGAAGG - Intergenic
942562402 2:177234705-177234727 GCAAATATCCAGTTTATAGAGGG + Intronic
942577796 2:177383284-177383306 TCAATTTTTAATATTATAAAGGG + Intronic
942668243 2:178345668-178345690 GTATTTCTTAATTTTATAAATGG - Intronic
943192186 2:184692907-184692929 TAAACTATTCATTTTATAGAAGG - Intronic
943709301 2:191072540-191072562 GGAATTATTATTTTTATAAATGG + Intronic
944137757 2:196418096-196418118 GCAGTACTTAATTTTGTAGAGGG + Intronic
944411083 2:199442739-199442761 TTAATTATTTATTTTAGAGATGG - Intronic
944552346 2:200856002-200856024 TCATTTATTTATTTTTTAGACGG - Intronic
945318462 2:208394793-208394815 AAAATTATTAATTTTATTTAAGG + Intronic
945483131 2:210365389-210365411 ACAATTTTTACTTCTATAGAAGG + Intergenic
945592320 2:211748684-211748706 TCACTTATTTATTTTACAGAGGG - Intronic
949083416 2:242123930-242123952 GCAATTATTCATTGAATAAATGG + Intergenic
1170361546 20:15551948-15551970 GCACTTATTACTTTCATATAAGG + Intronic
1170790430 20:19504395-19504417 TTAAATATTTATTTTATAGAAGG - Intronic
1171063201 20:21986780-21986802 GCTATTAATAATTTTGTAGAAGG + Intergenic
1172058323 20:32169903-32169925 CCCTTTATTAATGTTATAGAAGG - Intergenic
1172351738 20:34248198-34248220 GCAATTTTTTTTTTTTTAGATGG - Intronic
1172823007 20:37755247-37755269 ACAACTTTTAATTTTAGAGAGGG + Intronic
1173995770 20:47337493-47337515 TTATTTATTAATTATATAGAGGG - Intronic
1174817480 20:53699233-53699255 TCATTTATTTATTTTAGAGATGG + Intergenic
1175512567 20:59542127-59542149 ACAATTATTAATGTTCAAGAGGG - Intergenic
1176136369 20:63523804-63523826 GCAATTTTTACTTCTATAGAAGG + Intergenic
1176280010 20:64296551-64296573 GCAATTATTCATTGAATAAATGG + Intergenic
1176929989 21:14797888-14797910 GCATATATTCATTTTCTAGATGG - Intergenic
1177099507 21:16882746-16882768 GCAATGTTGAATTTTATGGAAGG - Intergenic
1177678952 21:24338992-24339014 GCATTTCTAAATTGTATAGATGG + Intergenic
1177716869 21:24850011-24850033 GCAACTAATCATTTTATAGGGGG - Intergenic
1178988513 21:37331204-37331226 GCAATTGTTAAATTGATAGGAGG - Intergenic
1180746488 22:18092535-18092557 GAAAATATTAATTGCATAGAAGG + Exonic
949295106 3:2512420-2512442 ATAAATATTAATTTGATAGATGG - Intronic
949734301 3:7153645-7153667 GCTATAATTAACTTTATAGGAGG + Intronic
949876515 3:8629492-8629514 CCACTTTTTCATTTTATAGACGG + Intronic
950191536 3:10980084-10980106 GTAATTAATATTTTTAAAGAGGG + Intergenic
951173429 3:19570585-19570607 TCAATGATTAATTTTTTAAAAGG - Intergenic
951827020 3:26879800-26879822 GCAATGTTGAATTTTATTGAAGG - Intergenic
952761760 3:36921356-36921378 GCAATTTTTACTTCTATAGGAGG - Intronic
953140449 3:40224695-40224717 GAAAATATTTCTTTTATAGATGG + Intronic
953615344 3:44485400-44485422 AAAATTATTTATTTTAGAGATGG + Intergenic
954507824 3:51093878-51093900 GCAGTGTTTAATTTTATCGAAGG + Intronic
954753637 3:52827426-52827448 GTAAGCATTCATTTTATAGAAGG + Intronic
955222412 3:57034124-57034146 GTACTTATTTATTTTAGAGATGG + Intronic
955316738 3:57945479-57945501 GCATGTATTAATTTTATATTAGG - Intergenic
956046116 3:65197815-65197837 GCATTTATTATTTTTATTGCAGG - Intergenic
957593511 3:82230274-82230296 TCAAGTTTTAATGTTATAGAAGG + Intergenic
957873995 3:86121322-86121344 GCAATGATTAATTTTATTAGGGG + Intergenic
957913380 3:86652984-86653006 GCAATTATAAAGTTCATGGAAGG - Intergenic
957967110 3:87336466-87336488 AGAAATATTAAATTTATAGATGG + Intergenic
957973098 3:87407904-87407926 GCAATGTTGAATTTTATCGAAGG - Intergenic
958539438 3:95451259-95451281 TCATTGAGTAATTTTATAGATGG - Intergenic
958642124 3:96817599-96817621 GAAATTTGTTATTTTATAGAGGG + Intronic
958875056 3:99606480-99606502 TTAATTATTTATTTTAGAGATGG - Intergenic
959487903 3:106949718-106949740 TCAAATATTATTTTTGTAGATGG + Intergenic
959517798 3:107289364-107289386 CCAAATAGTATTTTTATAGAAGG - Intergenic
959526661 3:107384837-107384859 GCAATTATTATCTTTATATTTGG - Intergenic
959942521 3:112094467-112094489 CCAAATATTAATATTACAGATGG - Intronic
960182395 3:114595951-114595973 TCAATTATTCAATTTATAAATGG + Intronic
960256893 3:115520083-115520105 GTATTTATTATTTTTTTAGATGG - Intergenic
961234743 3:125356595-125356617 GCGTTTCTTAATTTTATAGAGGG - Intronic
961931282 3:130536073-130536095 TCTATTTTTGATTTTATAGAAGG + Intergenic
962926720 3:140000320-140000342 GCACTTATTAATATTTTGGAAGG + Intronic
963016243 3:140826925-140826947 GTAATTTTTAATTTTAATGATGG - Intergenic
963178864 3:142332247-142332269 GTATTTATTTATTTTAGAGATGG - Intronic
963295883 3:143546002-143546024 TCAATCATTCATTTTACAGATGG + Intronic
964164558 3:153686624-153686646 ACAAGTAATAATTGTATAGAGGG + Intergenic
964183698 3:153917143-153917165 GCAATGTTGAATTTTATTGAAGG - Intergenic
964992394 3:162829482-162829504 GCAATTATGAAGATTTTAGAGGG - Intergenic
965274503 3:166663613-166663635 GTAATTTTTACTTCTATAGAAGG - Intergenic
965769376 3:172165536-172165558 GCAATTATTAAATATATTCATGG - Intronic
965932362 3:174060516-174060538 GCAAATATTCATTTTCTTGAAGG + Intronic
966508826 3:180737396-180737418 GCACTAATTTTTTTTATAGATGG - Intronic
966687598 3:182712738-182712760 TCATTTTTTAATTTTTTAGACGG - Intergenic
967033005 3:185625800-185625822 GCATTTATCAATTTTAAAAAGGG - Intronic
968372187 3:198229846-198229868 GCAATTATTCATTGAATAAATGG + Intergenic
970845189 4:20529176-20529198 GCAATTATTAATAATAAAAATGG - Intronic
970852816 4:20621837-20621859 GTAATTATTCATATTATAAAAGG + Intergenic
970939287 4:21612665-21612687 TCAATTATTCATTAAATAGATGG + Intronic
970963832 4:21904995-21905017 GCAATCCTTAATTTTATACCTGG - Intronic
971090639 4:23340980-23341002 TCAATTATTTCTTTCATAGATGG - Intergenic
971255041 4:25006548-25006570 GCAATAATTAGTTTTAAACAAGG - Intronic
972115385 4:35626218-35626240 ACAAATATTAATTTTAGTGAAGG - Intergenic
972777849 4:42259663-42259685 GCAACAATTAGTTTTATAGTAGG - Intergenic
972807973 4:42549792-42549814 CCAATTATTTTTTTTAGAGATGG - Intronic
972809532 4:42567201-42567223 GTAATTACTTATTTTATAGATGG + Intronic
972873967 4:43335084-43335106 GAAATTATTAATTTAGTAAATGG - Intergenic
973019482 4:45184375-45184397 CCAAATATTAATTTTATGAATGG - Intergenic
973039738 4:45455582-45455604 GCAATTATTATTTTTAAAAAAGG - Intergenic
973583092 4:52363564-52363586 GCATTTATTTATTTTATATATGG + Intergenic
976895818 4:90109739-90109761 GCACTTATTTATATTACAGAGGG + Intergenic
976932781 4:90589183-90589205 GCATTTATTAAAATTAGAGAGGG + Intronic
976968472 4:91075444-91075466 GCAAATATTACATTTATATATGG + Intronic
977166245 4:93702264-93702286 ACAATTATTTGTTTTACAGAAGG - Intronic
977190906 4:93999932-93999954 CCAAATATAAATTTAATAGAAGG - Intergenic
977329794 4:95623152-95623174 GCAATTTTCTATTTTATAGTTGG + Intergenic
977476066 4:97510961-97510983 GCTATTATTATTATTAGAGATGG - Intronic
977488201 4:97676421-97676443 GCAAAAATTAATTTAATACAGGG - Intronic
978010830 4:103682135-103682157 GTCATTATTATTTTTAGAGATGG + Intronic
978187218 4:105870672-105870694 AAAATTAGTAATTTTATAGTAGG - Intronic
978948364 4:114526172-114526194 GCAATGTTGAATTTTATTGAAGG + Intergenic
978950300 4:114550251-114550273 GCAATTATTATTATTACTGATGG + Intergenic
979260871 4:118642326-118642348 GCAATTATTCATTGAATAAATGG + Intergenic
979556988 4:122059296-122059318 GCATTTATTCATATTATAGGAGG - Intergenic
980050043 4:128030159-128030181 TCAATCATTTATTTTAAAGATGG - Intronic
980700699 4:136425432-136425454 CCATTTCTTAATCTTATAGAAGG - Intergenic
981683282 4:147424574-147424596 AGAATTATTATTTTTCTAGAAGG - Intergenic
982241073 4:153300001-153300023 GCAATTTTTACTTCTATAGAAGG - Intronic
983000651 4:162409544-162409566 GCAAGTATTATTTTCATAAATGG - Intergenic
983070514 4:163262597-163262619 ATATTTATTAAATTTATAGAAGG + Intergenic
983279838 4:165666507-165666529 GTAATTTCTAATTTAATAGAAGG - Intergenic
983381774 4:167004712-167004734 CTAATTATTAATATAATAGAAGG + Intronic
983442463 4:167804010-167804032 ACAATTTTTATTTCTATAGACGG - Intergenic
983637942 4:169917309-169917331 GCAATTTTTACTTCTATAGAAGG + Intergenic
983674057 4:170271142-170271164 GCAATTTTTACTTCTATAGAAGG - Intergenic
983679781 4:170339942-170339964 GCAATTTTTACTTCTATAGAAGG - Intergenic
984293683 4:177827301-177827323 GCAATTTATAAATTTAGAGAAGG - Intronic
986047888 5:4058603-4058625 ATTATTATTATTTTTATAGATGG + Intergenic
986502858 5:8418310-8418332 CCAATTAATAATTTAACAGAAGG + Intergenic
986939420 5:12932458-12932480 GCATTTATTTATTTTATATTAGG - Intergenic
986994762 5:13594261-13594283 GTAACTATTAATATTGTAGAAGG + Intergenic
990043603 5:51400938-51400960 GCAATTTTTTTTTTTATGGAGGG - Intergenic
990370704 5:55115201-55115223 GCAAATAATAATTTAACAGAAGG - Intronic
990389723 5:55307120-55307142 GCAATTATTTTGTTTTTAGAAGG + Intronic
990435455 5:55786017-55786039 GCAATTAATTCTATTATAGATGG - Intronic
990555576 5:56931990-56932012 ACAATTATAAATATAATAGAGGG + Intronic
990570045 5:57069314-57069336 GCAATTTTTACTTCTATAGAAGG + Intergenic
990811463 5:59729419-59729441 GCTATTATAAATTTTAAAAATGG - Intronic
990982749 5:61616405-61616427 ACAACTCTTTATTTTATAGATGG - Intergenic
991156268 5:63440110-63440132 TCTCATATTAATTTTATAGATGG + Intergenic
992470351 5:77046092-77046114 GCACTTCGTAATTTTATATATGG + Intronic
992566107 5:77996764-77996786 GCCATTCCTAATTTTATATATGG + Intergenic
993121609 5:83781518-83781540 GCAATTATTATTTTTATACATGG - Intergenic
993223873 5:85140182-85140204 ACAATTATTAAATATATATAAGG - Intergenic
993420350 5:87693910-87693932 GCAATGTTGAATTTTATGGAAGG + Intergenic
993562601 5:89429530-89429552 GTAATTATTATTTTTTGAGATGG + Intergenic
993943484 5:94090735-94090757 GCAGTGTTTAATTTTATCGAAGG + Intronic
994126817 5:96177102-96177124 ATTATTATTAATTTTAGAGATGG + Intergenic
994954391 5:106509690-106509712 GCAGTTATTTATTTGACAGAAGG - Intergenic
995407716 5:111819459-111819481 GCAATTTTTACTTCTATAGAAGG - Intronic
995616321 5:113968379-113968401 GTAATTATTCATTTTAAATAGGG - Intergenic
995667910 5:114565484-114565506 GCAATGATGATTTTTAAAGAAGG + Intergenic
996003424 5:118391008-118391030 GCAAATTTTGATTTTATAAAAGG + Intergenic
996076131 5:119196772-119196794 GCAATTATTAACTTCAAAGGAGG + Intronic
996162527 5:120182858-120182880 GCTATTATTTATTGTATAGTGGG - Intergenic
997312930 5:132904666-132904688 GAAATTAGTTATTTTATAAAGGG - Intronic
998113821 5:139521690-139521712 TTAATTATTATTTTTTTAGATGG + Intergenic
998750984 5:145320976-145320998 GTAAATAATAATTTTAGAGATGG - Intergenic
998979052 5:147680529-147680551 CCAAATATTAATTATAGAGAAGG - Intronic
999088730 5:148916058-148916080 CCAAGTATTAATTTTTTGGATGG - Intergenic
999674998 5:153990440-153990462 GAAATTGTAATTTTTATAGATGG - Exonic
1000388446 5:160698429-160698451 GGCATTATTAATTTTATGGTAGG + Intronic
1001345625 5:170895241-170895263 TCAAATCTTAATTTTATAGTTGG - Intronic
1001785772 5:174411734-174411756 GAAATTATTAATTTGGTAGAAGG - Intergenic
1001844361 5:174908309-174908331 GGAATGTTTAATTTTATAGAAGG - Intergenic
1002629760 5:180563896-180563918 GCAGTTATTGAATTTACAGATGG + Intronic
1002731429 5:181335396-181335418 GCAATTATTCATTGAATAAATGG + Intergenic
1002753111 6:138694-138716 GCAATTATTCATTGAATAAATGG - Intergenic
1003255530 6:4471716-4471738 GCAATTTTTACTTCTATAGAAGG - Intergenic
1003299606 6:4865468-4865490 GCAATTTTTACTTCTATAGAAGG - Intronic
1003845466 6:10169530-10169552 GAATTTATTTATTTTAGAGATGG - Intronic
1004117651 6:12786832-12786854 GAAATATGTAATTTTATAGATGG - Intronic
1005091306 6:22059743-22059765 GCCATTATTAAATTTATATTAGG - Intergenic
1005276319 6:24222460-24222482 GCAATTATGCCTTTTACAGAAGG - Intronic
1005281519 6:24279404-24279426 TTAATTGTTAATTTTAGAGATGG - Intronic
1005344681 6:24877685-24877707 GCAATTTTTACTTCTATATAAGG + Intronic
1005817170 6:29563182-29563204 GGAATTTTTACTTCTATAGAAGG + Intronic
1006677701 6:35776313-35776335 GTATTTATTTATTTTACAGACGG - Intergenic
1007061611 6:38945973-38945995 AAAATAATTAATTTTTTAGAGGG - Intronic
1007153220 6:39716174-39716196 GCTATCATTAATTTTACACAAGG - Intronic
1008733892 6:54518721-54518743 GCCATTATTTACTTTATTGATGG - Intergenic
1008950994 6:57159210-57159232 GCAAATATTAATATCATAAAAGG - Intronic
1009195323 6:60677779-60677801 GCAATTATGAATTCTATCCAGGG - Intergenic
1009936838 6:70244377-70244399 CCAATTTTTATATTTATAGATGG - Intronic
1010100010 6:72092898-72092920 GCAATTATTCCTTTTCTAGTTGG - Intronic
1010860575 6:80905196-80905218 AAAATTATTAAATTCATAGAAGG - Intergenic
1011137585 6:84116698-84116720 GCAATGTTAAATTTTATGGAAGG + Intergenic
1011513279 6:88125106-88125128 GCAATTTTTACTTCTACAGAAGG + Intergenic
1012343145 6:98153679-98153701 GCAATGTTTAATTTTATTGAAGG + Intergenic
1012748788 6:103130114-103130136 GGAATTATTTATTTGATATAAGG + Intergenic
1012749339 6:103138190-103138212 GTAAATATTAATTTTATAGAAGG + Intergenic
1013423978 6:109993958-109993980 GCAATTATTCTTTTGATACAAGG - Intergenic
1013931162 6:115534650-115534672 GCCATTGTTAAGTTTAAAGAGGG + Intergenic
1014102319 6:117525152-117525174 ATAATTATTAGTTTTATATAAGG - Intronic
1014412424 6:121142678-121142700 GCTATTTTTAATTTTCTATATGG + Intronic
1014707953 6:124771357-124771379 TCAATTATCAATTTTTTTGAGGG - Intronic
1014872257 6:126611210-126611232 GCAATGTTGAATTTTATCGAAGG + Intergenic
1015075419 6:129150889-129150911 GTGATTATTCATTTTATGGAGGG - Intronic
1015646575 6:135397606-135397628 GCAAATACTAATTCTCTAGACGG + Intronic
1015873667 6:137801610-137801632 CCATTTATTAACTTTACAGAAGG + Intergenic
1016036235 6:139386362-139386384 GCAATTATTTATATTTTAAATGG + Intergenic
1016070629 6:139734160-139734182 GCAAATATACATTTTATAAAAGG + Intergenic
1016079832 6:139842580-139842602 TCATTGATTAATTTTATAAAGGG - Intergenic
1017324016 6:153126493-153126515 GCTAATATTAATTTTTTAAAAGG - Intronic
1017846544 6:158263464-158263486 GCAATTATTAGTGCTATTGATGG + Intronic
1018113784 6:160563024-160563046 GGATTTATTAATTTTTTAAAGGG + Intronic
1020836048 7:13152743-13152765 GCATTTATTAATTTAGTACATGG - Intergenic
1021161873 7:17283721-17283743 GCAATGATTAATGTTGGAGAGGG + Intergenic
1021368570 7:19812585-19812607 AAAATTATTTATTTTAGAGATGG + Intergenic
1021611810 7:22465055-22465077 GCCATTATTCAGTTTATAAAAGG + Intronic
1023339333 7:39203193-39203215 ACACTTATAAATTTTAAAGAAGG - Intronic
1024076577 7:45822572-45822594 GCAATTATTCATTGAATAAATGG + Intergenic
1025059622 7:55794450-55794472 GCAATTATTCATTGAATAAATGG - Exonic
1025127841 7:56358856-56358878 GCAATTATTCATTGAATAAATGG - Intergenic
1025154704 7:56594258-56594280 CCAATTATTGATTTTTGAGATGG + Intergenic
1025615871 7:63116005-63116027 GCAATTATTCATTGAATAAATGG - Intergenic
1026130693 7:67618468-67618490 GCAATTATTCTTTAAATAGAAGG - Intergenic
1026198904 7:68196920-68196942 GCAAATACAAATTATATAGATGG + Intergenic
1026330543 7:69348350-69348372 GCATTTATTTATTTTTGAGAGGG - Intergenic
1026618647 7:71930837-71930859 GCAATTAAGCATTTTAAAGATGG - Intronic
1026781619 7:73271828-73271850 GAAATTATTATTTTTAGAGACGG + Intergenic
1027575902 7:79930652-79930674 GCAATGTTGAATTTTATCGAAGG + Intergenic
1027655385 7:80923957-80923979 GCATTTAATAACTTTAAAGAAGG + Intergenic
1028351197 7:89851178-89851200 CCAATTAGTTATCTTATAGAAGG + Intergenic
1028688548 7:93621992-93622014 GCACTTATTTATTTGATAAAGGG - Intronic
1028989277 7:97032723-97032745 GCAATTAGGAATTTTATATTTGG + Intergenic
1029052750 7:97706455-97706477 GCAACTATTAAGTTTTGAGAGGG - Intergenic
1030041245 7:105452415-105452437 ACAATTATGACTTTTTTAGAGGG + Intronic
1030384363 7:108849633-108849655 ACAAAAATTAATTTAATAGAAGG - Intergenic
1030638436 7:111976438-111976460 GAAATTTTTAATTTGAAAGACGG + Intronic
1030691907 7:112544399-112544421 GGATTTATTAATTTTTTTGAAGG + Intergenic
1030823559 7:114125741-114125763 CCACTTTTTAATTTTAGAGAAGG + Intronic
1030860893 7:114626505-114626527 TCTATGATTAACTTTATAGAAGG + Intronic
1030947759 7:115746599-115746621 AAAATTATTAATTTTAAAAATGG - Intergenic
1031555880 7:123175516-123175538 GGAATTAGTACTTTTATAAAAGG + Intronic
1031718703 7:125141101-125141123 GCAACTATTAATTTTTAAAAGGG + Intergenic
1031945685 7:127837893-127837915 GCAATTTTTACTTCTATAGAAGG + Intronic
1033008532 7:137593804-137593826 ACAATTTTGAATTTTCTAGAAGG - Intronic
1033430716 7:141287140-141287162 GCTTTTATAAATTTCATAGATGG + Intronic
1033464167 7:141576231-141576253 GCAATTTTTACTTCTATAGAAGG + Intronic
1033709061 7:143919734-143919756 GCGATGTTTAATTTTATTGAAGG + Intergenic
1034185411 7:149172455-149172477 GCAATTATTTATTTTTAAAAAGG - Intronic
1035123033 7:156584862-156584884 GCAAAAATTAATTTTAAAAATGG + Intergenic
1035140892 7:156759747-156759769 GCAATTTTTACTTCTATAGAAGG + Intronic
1035512083 8:198886-198908 GCAATTATTCATTGAATAAATGG - Intronic
1036104144 8:5822453-5822475 GCAATTTTTACTTCTATAGAAGG + Intergenic
1036105206 8:5830597-5830619 GCAATTTTTACTTCTATAGAAGG + Intergenic
1036121502 8:6022143-6022165 GTAATAATTAATTTTAGAGCAGG + Intergenic
1036374629 8:8189877-8189899 GTATTTATTTATTTTAGAGATGG - Intergenic
1036876272 8:12475758-12475780 GTATTTATTTATTTTAGAGATGG + Intergenic
1037626768 8:20614926-20614948 TACATTATTAATATTATAGAAGG + Intergenic
1038666557 8:29542698-29542720 GCACTTATTAAATTTAGTGAGGG - Intergenic
1038823982 8:30980657-30980679 ACAATTATAAAATTTATGGAAGG + Intergenic
1038853036 8:31298817-31298839 GCAATTTTTAAATTTATATTAGG - Intergenic
1039597559 8:38804605-38804627 GCAATTTTTTATTTTTCAGATGG + Intronic
1039847668 8:41337217-41337239 GCTATTTTTATTTTTAGAGATGG + Intergenic
1041244113 8:55874732-55874754 ACAATTATTATTTTTTGAGATGG - Intergenic
1041652250 8:60312689-60312711 ACAAAAATTAATTTTATAAATGG - Intergenic
1041723449 8:60997108-60997130 GCAATTTTTGATTTTCTTGATGG + Intergenic
1042079548 8:65036263-65036285 GAAATAATTGATATTATAGATGG - Intergenic
1042090182 8:65151075-65151097 GATATTATTTATTTTATAGTTGG + Intergenic
1042337959 8:67648314-67648336 GTAAATACTAATTTTATACACGG - Intronic
1042394179 8:68272352-68272374 GCATTCATTAATTTTTTTGAAGG - Intergenic
1043258369 8:78163577-78163599 GCAATAATAAATTTACTAGAGGG + Intergenic
1043598354 8:81911287-81911309 GCAATTTTTACTTCTATAGAAGG + Intergenic
1043660149 8:82728800-82728822 GTAATTTCCAATTTTATAGATGG - Intergenic
1044465496 8:92498948-92498970 TCAATAATTAACTTTATGGAGGG + Intergenic
1044645126 8:94432896-94432918 GAAATTACAAATATTATAGAAGG + Intronic
1044800821 8:95953338-95953360 GCAATTTTTAATTATTTTGATGG + Intergenic
1045026003 8:98087311-98087333 GCAAATATTTCTTTTTTAGAAGG + Intronic
1045149850 8:99392284-99392306 GAAATAAATTATTTTATAGAAGG - Intronic
1045374869 8:101561609-101561631 CCCTTTATTAATGTTATAGAAGG - Intronic
1046163991 8:110405014-110405036 ACAAATATTAACTTTATAGAAGG + Intergenic
1046192429 8:110814179-110814201 GCAATTATAGATTTAATAAAGGG + Intergenic
1046382264 8:113466862-113466884 TGAATTAGTACTTTTATAGAAGG + Intergenic
1046861011 8:119091692-119091714 AGAATTATTAATTTAAAAGAAGG - Intronic
1046873919 8:119233361-119233383 GGATTCATTAATTTTTTAGAGGG - Intronic
1047574969 8:126143031-126143053 GCAATTTTTACTTCTTTAGAAGG + Intergenic
1048008676 8:130439474-130439496 GCTATTATTATTATTATTGATGG - Intronic
1048505968 8:135022023-135022045 GCAATTTTTACTTTTATAGAAGG + Intergenic
1049862060 8:144905770-144905792 GCAATTTTTAATGTTAAACATGG - Intergenic
1050340006 9:4627344-4627366 CCAATGATTAATTTTAAGGAAGG - Intronic
1050804955 9:9664255-9664277 GCAGTTATTAAGTTCATAGATGG - Intronic
1051702913 9:19843506-19843528 GAAATTATTATTTTTTTATATGG - Intergenic
1051836099 9:21339736-21339758 CATATTATTTATTTTATAGATGG - Intergenic
1051986937 9:23100849-23100871 AGATTTATTAATTTTTTAGAAGG - Intergenic
1052188575 9:25629177-25629199 CCAATTACAAATCTTATAGATGG + Intergenic
1052316387 9:27120069-27120091 GCAATGATTAATAAAATAGATGG - Intronic
1053448323 9:38170833-38170855 GCAATTTTTACTTCTATAGAAGG + Intergenic
1054338129 9:63827328-63827350 GCATTCATTAATTTTTTTGAAGG + Intergenic
1054794348 9:69285726-69285748 GGAATTTTAAATTTTATTGAAGG + Intergenic
1055094382 9:72396031-72396053 GAAATCATTAATTTTGTAAAGGG + Intergenic
1056184767 9:84123254-84123276 TTCATTATTGATTTTATAGAAGG - Intergenic
1056267808 9:84916922-84916944 GCAACAATTAATTTTATGGTAGG - Intronic
1056421956 9:86437014-86437036 GCAATTTTTACTTCTATAGAAGG - Intergenic
1057007946 9:91577097-91577119 CCAATTCTTAATTCTATAGTTGG - Intronic
1057318284 9:93986685-93986707 GCAATTTTTACTTCTATTGAAGG - Intergenic
1057810994 9:98256361-98256383 GCTATTATTATTTTTAGAGACGG + Intergenic
1058882128 9:109294620-109294642 ACAATTATTATTTTTTTTGAGGG - Intronic
1059460577 9:114427090-114427112 GCTATTATTATTTTTAGAAATGG - Intronic
1059837826 9:118177160-118177182 GCTATGATTAACTTTGTAGAAGG - Intergenic
1059862603 9:118481632-118481654 GCAAATACTAATTCTTTAGATGG + Intergenic
1059906381 9:118991365-118991387 CCAATCTTTTATTTTATAGATGG + Intergenic
1060859491 9:126942994-126943016 GAAATTGTTGATTTTATAGCTGG + Intronic
1060991045 9:127849302-127849324 GCAATTTTTACTTCTACAGAAGG - Intronic
1061411493 9:130424544-130424566 GAAATTAATAAATTTATACAAGG - Intronic
1062755834 9:138287900-138287922 GCAATTATTCATTGAATAAATGG + Intergenic
1188254863 X:27949413-27949435 GAAATAATTATTTTTAAAGAAGG - Intergenic
1188459530 X:30407803-30407825 GAATTTATTCATTTTATAGCTGG - Intergenic
1188597018 X:31914020-31914042 GCAATTATTACTTTGATGGTGGG + Intronic
1188607577 X:32051365-32051387 TCAATTATGTATTTTATATAAGG + Intronic
1188850338 X:35124303-35124325 GCAAATAGAGATTTTATAGAAGG - Intergenic
1190420554 X:50280496-50280518 GCAATAAAAAATTTTATAGTAGG + Intronic
1190705011 X:53020203-53020225 GAAATGTTTAATTTTGTAGATGG + Intergenic
1191847662 X:65560488-65560510 GGAAGAATTAATTTTCTAGAAGG - Intergenic
1192943767 X:75942080-75942102 GCAATGTTGAATTTTATTGAAGG + Intergenic
1193195650 X:78628504-78628526 GCAATGTTGAATTTTATTGAAGG + Intergenic
1193302748 X:79910921-79910943 ACAATTAATATTTTTAAAGAAGG + Intergenic
1193986462 X:88247057-88247079 GAAGTTTTTAATTTTATTGATGG + Intergenic
1194248391 X:91542562-91542584 GCAATGTTTAATTTTATCAAAGG - Intergenic
1194268473 X:91781864-91781886 GCAATTCTTAATTTAGTCGAGGG - Intronic
1194423254 X:93703214-93703236 TCAGTTATTTATTTTATAGAAGG - Intronic
1194974855 X:100384380-100384402 AGAATTATTAGTTTCATAGATGG - Intronic
1195438687 X:104876035-104876057 GCAATTAGTAATTCTTTAGTGGG + Intronic
1196513483 X:116542773-116542795 GCAATGTTGAATTTTATTGAAGG + Intergenic
1196840804 X:119857288-119857310 ACAATTTTTACTTCTATAGAAGG - Intergenic
1198117101 X:133554864-133554886 GCAATTTTTACTTCTATAGAAGG - Intronic
1198132915 X:133716929-133716951 GCAACTGTTAATCTTATTGAGGG - Intronic
1198233007 X:134711020-134711042 GCATTTTTTATTTTTAAAGAAGG + Intronic
1198341753 X:135720833-135720855 GGAATTATTTATTTCATAAATGG - Intronic
1198346241 X:135762529-135762551 GGAATTATTTATTTCATAAATGG + Intronic
1198348147 X:135779814-135779836 GGAATTATTTATTTCATAAATGG + Intergenic
1198350053 X:135797076-135797098 GGAATTATTTATTTCATAAATGG + Intronic
1198351963 X:135814349-135814371 GGAATTATTTATTTAATAAATGG + Intronic
1198353867 X:135831618-135831640 GGAATTATTTATTTCATAAATGG + Intronic
1198355779 X:135848867-135848889 GGAATTATTTATTTAATAAATGG + Intronic
1198357690 X:135866146-135866168 GGAATTATTTATTTAATAAATGG + Intergenic
1198359604 X:135883429-135883451 GGAATTATTTATTTCATAAATGG + Intronic
1198366461 X:135945207-135945229 GGAATTATTTATTTCATAAATGG + Intergenic
1198590236 X:138171784-138171806 AGAATTATTAATTAGATAGAAGG - Intergenic
1199362701 X:146941933-146941955 GTATTTATTAATTTTAAAGTAGG + Intergenic
1199840647 X:151644160-151644182 CCAATTATTTATTTAATAAAAGG + Intronic
1200567404 Y:4784082-4784104 GCAATGTTTAATTTTATCAAAGG - Intergenic
1200585672 Y:5002777-5002799 GCAATTCTTAATTTAGTCGAGGG - Intronic
1201296640 Y:12469086-12469108 GCAATTTTTACTTCTATAGAAGG + Intergenic
1201433979 Y:13936779-13936801 GCATTTATTTATTTTTTAGATGG - Intergenic
1201903703 Y:19068355-19068377 ACAATTTTTACTTCTATAGAAGG + Intergenic
1201958670 Y:19653728-19653750 GGAAGTATTAATTGAATAGACGG + Intergenic
1202050385 Y:20774683-20774705 GCCATTATTATTTTTCTAGAAGG + Intronic
1202382342 Y:24284728-24284750 GCAATTATTCATTGAATAAATGG + Intergenic
1202488442 Y:25385397-25385419 GCAATTATTCATTGAATAAATGG - Intergenic