ID: 1118061095

View in Genome Browser
Species Human (GRCh38)
Location 14:62138555-62138577
Sequence ACTGATAAAAAGAAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118061095_1118061098 -9 Left 1118061095 14:62138555-62138577 CCCTCCACTTTCTTTTTATCAGT No data
Right 1118061098 14:62138569-62138591 TTTATCAGTTTGTGAAAAAAAGG No data
1118061095_1118061099 -8 Left 1118061095 14:62138555-62138577 CCCTCCACTTTCTTTTTATCAGT No data
Right 1118061099 14:62138570-62138592 TTATCAGTTTGTGAAAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118061095 Original CRISPR ACTGATAAAAAGAAAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr