ID: 1118064480

View in Genome Browser
Species Human (GRCh38)
Location 14:62175899-62175921
Sequence AACCATGAACAACTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118064480_1118064482 21 Left 1118064480 14:62175899-62175921 CCTGTCTGTAGTTGTTCATGGTT No data
Right 1118064482 14:62175943-62175965 ACCAATTGTGTGTCAGTATTGGG No data
1118064480_1118064481 20 Left 1118064480 14:62175899-62175921 CCTGTCTGTAGTTGTTCATGGTT No data
Right 1118064481 14:62175942-62175964 TACCAATTGTGTGTCAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118064480 Original CRISPR AACCATGAACAACTACAGAC AGG (reversed) Intergenic
No off target data available for this crispr