ID: 1118065913

View in Genome Browser
Species Human (GRCh38)
Location 14:62190012-62190034
Sequence GAAACATCAAGGCTATGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118065913_1118065926 23 Left 1118065913 14:62190012-62190034 CCCCCCCATAGCCTTGATGTTTC No data
Right 1118065926 14:62190058-62190080 CCACCATCAAACCTGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118065913 Original CRISPR GAAACATCAAGGCTATGGGG GGG (reversed) Intergenic
No off target data available for this crispr