ID: 1118069864

View in Genome Browser
Species Human (GRCh38)
Location 14:62234477-62234499
Sequence CAATAATAGGAGAACTAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118069864_1118069869 -5 Left 1118069864 14:62234477-62234499 CCCCACTAGTTCTCCTATTATTG No data
Right 1118069869 14:62234495-62234517 TATTGAGAGAATATTTATATGGG No data
1118069864_1118069868 -6 Left 1118069864 14:62234477-62234499 CCCCACTAGTTCTCCTATTATTG No data
Right 1118069868 14:62234494-62234516 TTATTGAGAGAATATTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118069864 Original CRISPR CAATAATAGGAGAACTAGTG GGG (reversed) Intergenic
No off target data available for this crispr