ID: 1118072707

View in Genome Browser
Species Human (GRCh38)
Location 14:62263304-62263326
Sequence AATCTCCAGGGAACCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118072707_1118072711 1 Left 1118072707 14:62263304-62263326 CCTTCTGAGGTTCCCTGGAGATT No data
Right 1118072711 14:62263328-62263350 GGATGTCAACATGCAAATTTTGG No data
1118072707_1118072712 2 Left 1118072707 14:62263304-62263326 CCTTCTGAGGTTCCCTGGAGATT No data
Right 1118072712 14:62263329-62263351 GATGTCAACATGCAAATTTTGGG No data
1118072707_1118072713 3 Left 1118072707 14:62263304-62263326 CCTTCTGAGGTTCCCTGGAGATT No data
Right 1118072713 14:62263330-62263352 ATGTCAACATGCAAATTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118072707 Original CRISPR AATCTCCAGGGAACCTCAGA AGG (reversed) Intergenic
No off target data available for this crispr