ID: 1118073232

View in Genome Browser
Species Human (GRCh38)
Location 14:62269213-62269235
Sequence TAGATAAGGATAGAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073232_1118073242 24 Left 1118073232 14:62269213-62269235 CCTCCACCCTCTATCCTTATCTA No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073232_1118073239 6 Left 1118073232 14:62269213-62269235 CCTCCACCCTCTATCCTTATCTA No data
Right 1118073239 14:62269242-62269264 CAGTTACCCATGGTCAACAGTGG No data
1118073232_1118073238 -4 Left 1118073232 14:62269213-62269235 CCTCCACCCTCTATCCTTATCTA No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073232 Original CRISPR TAGATAAGGATAGAGGGTGG AGG (reversed) Intergenic
No off target data available for this crispr