ID: 1118073235

View in Genome Browser
Species Human (GRCh38)
Location 14:62269219-62269241
Sequence ACACCATAGATAAGGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073235_1118073239 0 Left 1118073235 14:62269219-62269241 CCCTCTATCCTTATCTATGGTGT No data
Right 1118073239 14:62269242-62269264 CAGTTACCCATGGTCAACAGTGG No data
1118073235_1118073238 -10 Left 1118073235 14:62269219-62269241 CCCTCTATCCTTATCTATGGTGT No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073235_1118073242 18 Left 1118073235 14:62269219-62269241 CCCTCTATCCTTATCTATGGTGT No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073235 Original CRISPR ACACCATAGATAAGGATAGA GGG (reversed) Intergenic
No off target data available for this crispr