ID: 1118073238

View in Genome Browser
Species Human (GRCh38)
Location 14:62269232-62269254
Sequence TCTATGGTGTCAGTTACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073230_1118073238 -2 Left 1118073230 14:62269211-62269233 CCCCTCCACCCTCTATCCTTATC No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073229_1118073238 -1 Left 1118073229 14:62269210-62269232 CCCCCTCCACCCTCTATCCTTAT No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073233_1118073238 -7 Left 1118073233 14:62269216-62269238 CCACCCTCTATCCTTATCTATGG No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073232_1118073238 -4 Left 1118073232 14:62269213-62269235 CCTCCACCCTCTATCCTTATCTA No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073235_1118073238 -10 Left 1118073235 14:62269219-62269241 CCCTCTATCCTTATCTATGGTGT No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data
1118073231_1118073238 -3 Left 1118073231 14:62269212-62269234 CCCTCCACCCTCTATCCTTATCT No data
Right 1118073238 14:62269232-62269254 TCTATGGTGTCAGTTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073238 Original CRISPR TCTATGGTGTCAGTTACCCA TGG Intergenic
No off target data available for this crispr