ID: 1118073242

View in Genome Browser
Species Human (GRCh38)
Location 14:62269260-62269282
Sequence AGTGGTTCAAAAATAGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073232_1118073242 24 Left 1118073232 14:62269213-62269235 CCTCCACCCTCTATCCTTATCTA No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073237_1118073242 10 Left 1118073237 14:62269227-62269249 CCTTATCTATGGTGTCAGTTACC No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073229_1118073242 27 Left 1118073229 14:62269210-62269232 CCCCCTCCACCCTCTATCCTTAT No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073236_1118073242 17 Left 1118073236 14:62269220-62269242 CCTCTATCCTTATCTATGGTGTC No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073231_1118073242 25 Left 1118073231 14:62269212-62269234 CCCTCCACCCTCTATCCTTATCT No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073230_1118073242 26 Left 1118073230 14:62269211-62269233 CCCCTCCACCCTCTATCCTTATC No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073235_1118073242 18 Left 1118073235 14:62269219-62269241 CCCTCTATCCTTATCTATGGTGT No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data
1118073233_1118073242 21 Left 1118073233 14:62269216-62269238 CCACCCTCTATCCTTATCTATGG No data
Right 1118073242 14:62269260-62269282 AGTGGTTCAAAAATAGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073242 Original CRISPR AGTGGTTCAAAAATAGTAAA TGG Intergenic
No off target data available for this crispr