ID: 1118073466 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:62271450-62271472 |
| Sequence | CTGGGGCTAAGTGGGGAAAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1118073466_1118073473 | -5 | Left | 1118073466 | 14:62271450-62271472 | CCAGTTTCCCCACTTAGCCCCAG | No data | ||
| Right | 1118073473 | 14:62271468-62271490 | CCCAGGTGAAACAAACCCATAGG | No data | ||||
| 1118073466_1118073477 | 11 | Left | 1118073466 | 14:62271450-62271472 | CCAGTTTCCCCACTTAGCCCCAG | No data | ||
| Right | 1118073477 | 14:62271484-62271506 | CCATAGGTCTCTGTGCCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1118073466 | Original CRISPR | CTGGGGCTAAGTGGGGAAAC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||