ID: 1118073466

View in Genome Browser
Species Human (GRCh38)
Location 14:62271450-62271472
Sequence CTGGGGCTAAGTGGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073466_1118073473 -5 Left 1118073466 14:62271450-62271472 CCAGTTTCCCCACTTAGCCCCAG No data
Right 1118073473 14:62271468-62271490 CCCAGGTGAAACAAACCCATAGG No data
1118073466_1118073477 11 Left 1118073466 14:62271450-62271472 CCAGTTTCCCCACTTAGCCCCAG No data
Right 1118073477 14:62271484-62271506 CCATAGGTCTCTGTGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073466 Original CRISPR CTGGGGCTAAGTGGGGAAAC TGG (reversed) Intergenic
No off target data available for this crispr