ID: 1118073777

View in Genome Browser
Species Human (GRCh38)
Location 14:62276274-62276296
Sequence GGGGCTTTTGCCGCTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118073777_1118073786 30 Left 1118073777 14:62276274-62276296 CCCAGAGAAGCGGCAAAAGCCCC No data
Right 1118073786 14:62276327-62276349 CCTATGATGAGAACCGTGTAGGG No data
1118073777_1118073784 29 Left 1118073777 14:62276274-62276296 CCCAGAGAAGCGGCAAAAGCCCC No data
Right 1118073784 14:62276326-62276348 CCCTATGATGAGAACCGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118073777 Original CRISPR GGGGCTTTTGCCGCTTCTCT GGG (reversed) Intergenic
No off target data available for this crispr