ID: 1118075497

View in Genome Browser
Species Human (GRCh38)
Location 14:62293861-62293883
Sequence GGCCAGGTAGAGAATCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118075494_1118075497 -2 Left 1118075494 14:62293840-62293862 CCTCACAATGATTAATTTCTTGG No data
Right 1118075497 14:62293861-62293883 GGCCAGGTAGAGAATCTTGTTGG No data
1118075493_1118075497 23 Left 1118075493 14:62293815-62293837 CCAGTTGAGAATGTCTTTATTCT No data
Right 1118075497 14:62293861-62293883 GGCCAGGTAGAGAATCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118075497 Original CRISPR GGCCAGGTAGAGAATCTTGT TGG Intergenic
No off target data available for this crispr