ID: 1118081081

View in Genome Browser
Species Human (GRCh38)
Location 14:62361638-62361660
Sequence TGGGAATACAATGAAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118081081_1118081084 0 Left 1118081081 14:62361638-62361660 CCAGCTGTTTCATTGTATTCCCA No data
Right 1118081084 14:62361661-62361683 AGCACAGTTCAGCCACCATGTGG No data
1118081081_1118081085 6 Left 1118081081 14:62361638-62361660 CCAGCTGTTTCATTGTATTCCCA No data
Right 1118081085 14:62361667-62361689 GTTCAGCCACCATGTGGCCCTGG No data
1118081081_1118081086 9 Left 1118081081 14:62361638-62361660 CCAGCTGTTTCATTGTATTCCCA No data
Right 1118081086 14:62361670-62361692 CAGCCACCATGTGGCCCTGGTGG No data
1118081081_1118081091 27 Left 1118081081 14:62361638-62361660 CCAGCTGTTTCATTGTATTCCCA No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118081081 Original CRISPR TGGGAATACAATGAAACAGC TGG (reversed) Intergenic
No off target data available for this crispr