ID: 1118081082

View in Genome Browser
Species Human (GRCh38)
Location 14:62361657-62361679
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118081082_1118081091 8 Left 1118081082 14:62361657-62361679 CCCAAGCACAGTTCAGCCACCAT No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data
1118081082_1118081086 -10 Left 1118081082 14:62361657-62361679 CCCAAGCACAGTTCAGCCACCAT No data
Right 1118081086 14:62361670-62361692 CAGCCACCATGTGGCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118081082 Original CRISPR ATGGTGGCTGAACTGTGCTT GGG (reversed) Intergenic
No off target data available for this crispr