ID: 1118081083

View in Genome Browser
Species Human (GRCh38)
Location 14:62361658-62361680
Sequence CATGGTGGCTGAACTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118081083_1118081091 7 Left 1118081083 14:62361658-62361680 CCAAGCACAGTTCAGCCACCATG No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118081083 Original CRISPR CATGGTGGCTGAACTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr