ID: 1118081091

View in Genome Browser
Species Human (GRCh38)
Location 14:62361688-62361710
Sequence GGTGGCATCCTCATTCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118081087_1118081091 -8 Left 1118081087 14:62361673-62361695 CCACCATGTGGCCCTGGTGGCAT No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data
1118081083_1118081091 7 Left 1118081083 14:62361658-62361680 CCAAGCACAGTTCAGCCACCATG No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data
1118081082_1118081091 8 Left 1118081082 14:62361657-62361679 CCCAAGCACAGTTCAGCCACCAT No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data
1118081080_1118081091 28 Left 1118081080 14:62361637-62361659 CCCAGCTGTTTCATTGTATTCCC No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data
1118081081_1118081091 27 Left 1118081081 14:62361638-62361660 CCAGCTGTTTCATTGTATTCCCA No data
Right 1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118081091 Original CRISPR GGTGGCATCCTCATTCTCTC AGG Intergenic
No off target data available for this crispr