ID: 1118085599

View in Genome Browser
Species Human (GRCh38)
Location 14:62412434-62412456
Sequence CCAGATACATGGTCTCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118085592_1118085599 21 Left 1118085592 14:62412390-62412412 CCTAGTTTGATTGTCTTTGGAGC No data
Right 1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG No data
1118085591_1118085599 22 Left 1118085591 14:62412389-62412411 CCCTAGTTTGATTGTCTTTGGAG No data
Right 1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118085599 Original CRISPR CCAGATACATGGTCTCTGAA AGG Intergenic
No off target data available for this crispr