ID: 1118086933

View in Genome Browser
Species Human (GRCh38)
Location 14:62428570-62428592
Sequence CGACAAAACCACATGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118086926_1118086933 17 Left 1118086926 14:62428530-62428552 CCAAGAGGGACAAAAGGGTAGAT No data
Right 1118086933 14:62428570-62428592 CGACAAAACCACATGAAGCCTGG No data
1118086922_1118086933 28 Left 1118086922 14:62428519-62428541 CCTCATGTCACCCAAGAGGGACA No data
Right 1118086933 14:62428570-62428592 CGACAAAACCACATGAAGCCTGG No data
1118086925_1118086933 18 Left 1118086925 14:62428529-62428551 CCCAAGAGGGACAAAAGGGTAGA No data
Right 1118086933 14:62428570-62428592 CGACAAAACCACATGAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118086933 Original CRISPR CGACAAAACCACATGAAGCC TGG Intergenic
No off target data available for this crispr