ID: 1118096828

View in Genome Browser
Species Human (GRCh38)
Location 14:62546555-62546577
Sequence CACTGCAGGCTAAAGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118096820_1118096828 14 Left 1118096820 14:62546518-62546540 CCCAGTGGTTGATATCTGAGTTC No data
Right 1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG No data
1118096821_1118096828 13 Left 1118096821 14:62546519-62546541 CCAGTGGTTGATATCTGAGTTCC No data
Right 1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG No data
1118096822_1118096828 -8 Left 1118096822 14:62546540-62546562 CCATTTAGTCCCTACCACTGCAG No data
Right 1118096828 14:62546555-62546577 CACTGCAGGCTAAAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118096828 Original CRISPR CACTGCAGGCTAAAGTGGTC TGG Intergenic
No off target data available for this crispr