ID: 1118098820

View in Genome Browser
Species Human (GRCh38)
Location 14:62571603-62571625
Sequence CTAGTGCCTGACTGTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118098820_1118098823 28 Left 1118098820 14:62571603-62571625 CCCACATTACAGTCAGGCACTAG No data
Right 1118098823 14:62571654-62571676 ACCTGAGGCATGTTTTAATTTGG No data
1118098820_1118098822 13 Left 1118098820 14:62571603-62571625 CCCACATTACAGTCAGGCACTAG No data
Right 1118098822 14:62571639-62571661 AGAAATGTACTTGTTACCTGAGG No data
1118098820_1118098826 30 Left 1118098820 14:62571603-62571625 CCCACATTACAGTCAGGCACTAG No data
Right 1118098826 14:62571656-62571678 CTGAGGCATGTTTTAATTTGGGG No data
1118098820_1118098825 29 Left 1118098820 14:62571603-62571625 CCCACATTACAGTCAGGCACTAG No data
Right 1118098825 14:62571655-62571677 CCTGAGGCATGTTTTAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118098820 Original CRISPR CTAGTGCCTGACTGTAATGT GGG (reversed) Intergenic
No off target data available for this crispr