ID: 1118099549

View in Genome Browser
Species Human (GRCh38)
Location 14:62581192-62581214
Sequence CAGAGATCCAACTTTAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118099549_1118099554 5 Left 1118099549 14:62581192-62581214 CCCACTTTAAAGTTGGATCTCTG No data
Right 1118099554 14:62581220-62581242 ATCCACCATGGAGGTGCCAGAGG No data
1118099549_1118099552 -7 Left 1118099549 14:62581192-62581214 CCCACTTTAAAGTTGGATCTCTG No data
Right 1118099552 14:62581208-62581230 ATCTCTGGTTGAATCCACCATGG No data
1118099549_1118099553 -4 Left 1118099549 14:62581192-62581214 CCCACTTTAAAGTTGGATCTCTG No data
Right 1118099553 14:62581211-62581233 TCTGGTTGAATCCACCATGGAGG No data
1118099549_1118099557 17 Left 1118099549 14:62581192-62581214 CCCACTTTAAAGTTGGATCTCTG No data
Right 1118099557 14:62581232-62581254 GGTGCCAGAGGATAGAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118099549 Original CRISPR CAGAGATCCAACTTTAAAGT GGG (reversed) Intergenic
No off target data available for this crispr