ID: 1118107686

View in Genome Browser
Species Human (GRCh38)
Location 14:62678751-62678773
Sequence CTGTGTAACTACAAGTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118107686_1118107691 29 Left 1118107686 14:62678751-62678773 CCAAAATACTTGTAGTTACACAG No data
Right 1118107691 14:62678803-62678825 CTGAGAATCTTCTACAAGCAGGG No data
1118107686_1118107689 4 Left 1118107686 14:62678751-62678773 CCAAAATACTTGTAGTTACACAG No data
Right 1118107689 14:62678778-62678800 GCACAGAAGATGCTAACTTGAGG No data
1118107686_1118107690 28 Left 1118107686 14:62678751-62678773 CCAAAATACTTGTAGTTACACAG No data
Right 1118107690 14:62678802-62678824 ACTGAGAATCTTCTACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118107686 Original CRISPR CTGTGTAACTACAAGTATTT TGG (reversed) Intergenic
No off target data available for this crispr