ID: 1118110767

View in Genome Browser
Species Human (GRCh38)
Location 14:62716550-62716572
Sequence CAGTGGGTGAGGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1179
Summary {0: 1, 1: 0, 2: 11, 3: 111, 4: 1056}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118110767 Original CRISPR CAGTGGGTGAGGAGGAAGAA GGG (reversed) Intronic
900331592 1:2137494-2137516 CAGTGGCTGCGGGGGAAGGAGGG - Intronic
901242083 1:7701321-7701343 CTGTTGCAGAGGAGGAAGAAGGG - Intronic
901296820 1:8167229-8167251 CAGAGGGGGAGGAGGAACAATGG + Intergenic
901436694 1:9250963-9250985 GAGGGGGTGGGGAGGAGGAAAGG + Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901928959 1:12584468-12584490 GGGGGGGTGAGGAGGCAGAAAGG - Intronic
902079165 1:13809361-13809383 CAGTGGTAGAAGAGGAAGGAAGG + Intronic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903340322 1:22650430-22650452 CAGTGGGAGAGCAGGAGGCAGGG + Intergenic
904294200 1:29507200-29507222 CAGAGGGTGAGGGGTAATAATGG - Intergenic
904539932 1:31225905-31225927 CACTGGGTGGGGAGGAGCAAGGG + Intronic
904568965 1:31446429-31446451 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
904848824 1:33441507-33441529 AAGGGGAGGAGGAGGAAGAAGGG - Intergenic
904988484 1:34572578-34572600 TTGTGGGCCAGGAGGAAGAAGGG + Intergenic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905236568 1:36554190-36554212 CTGTGGGTGCGGAGCAAGCATGG - Intergenic
905468645 1:38175365-38175387 CAGTGTGTGAGGAAGAAAACAGG - Intergenic
905787925 1:40772595-40772617 CAGTGGGTGAGGTGGAAATTGGG + Intergenic
905790724 1:40787905-40787927 TAGTGGCTGGGGAGGATGAAGGG - Intronic
905794121 1:40805944-40805966 CAGAGGCTGAGGCAGAAGAATGG - Intronic
905850993 1:41274820-41274842 CACAGGGTGAGGAGAAAGAGAGG - Intergenic
905856891 1:41320302-41320324 CAGGGGGTGGGGAAGAGGAAGGG + Intergenic
905871442 1:41406686-41406708 CAGGGGGAGAAGAGGAAAAAGGG - Intergenic
906090695 1:43176973-43176995 CGGGGGGTGAGGAGCAAGAGGGG + Intronic
906100429 1:43256948-43256970 CAGCTGGTGAGGAGGAAGTATGG + Intronic
906166253 1:43688649-43688671 TCGTGGGGCAGGAGGAAGAATGG + Intronic
906279602 1:44544070-44544092 CTGGGGATGAGGAGGAAGATGGG - Intronic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906675264 1:47688665-47688687 CAGTGTGTGAGGCGTTAGAAAGG + Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
907014274 1:50996451-50996473 AAATGGGAGATGAGGAAGAATGG + Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907205485 1:52766901-52766923 CAGAGGCTGAGGCGGGAGAATGG + Intronic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
907887784 1:58609467-58609489 CAGTAGGTGGGGAGGAGGGAAGG - Intergenic
908122733 1:61001279-61001301 GAGTGGGTGAAGAAGGAGAAGGG - Intronic
908274028 1:62450500-62450522 CATTGAATGAGGAGGAAGCAAGG + Exonic
908352941 1:63303905-63303927 GTGTTGGGGAGGAGGAAGAAGGG + Intergenic
909085215 1:71162288-71162310 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
909269711 1:73607135-73607157 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
909344030 1:74564609-74564631 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
909420502 1:75459519-75459541 CATTTGGTGAGGTGCAAGAAAGG + Intronic
909583072 1:77260015-77260037 CAGAGGATGAGGATGTAGAAGGG - Intergenic
909686535 1:78355172-78355194 AAGAGGGAAAGGAGGAAGAAGGG - Intronic
910206714 1:84755478-84755500 CAGTGGGTGGGGTAAAAGAAGGG - Intergenic
910242425 1:85101621-85101643 CAGAGGCTGAGGCGGGAGAATGG + Intronic
910242660 1:85104223-85104245 CAGAGGCTGAGGCGGGAGAACGG - Intronic
910745965 1:90575283-90575305 CAGGGGGTGGGGAGGGGGAAGGG + Intergenic
910867460 1:91801418-91801440 CACTGGGTGAGGAGAGGGAAAGG + Intronic
910867652 1:91802872-91802894 CATTGGGTGAGGAGAGGGAAGGG - Intronic
911160010 1:94674793-94674815 CACTGGGTGGGCAGGAAGTAGGG - Intergenic
911564785 1:99450968-99450990 TAGTGGGTGGGGAGGAAGTGGGG + Intergenic
911586990 1:99703000-99703022 CACTGGGTGTGGGGCAAGAAGGG - Intergenic
911667137 1:100565730-100565752 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
911721081 1:101191883-101191905 CAGAGGGAGAAGAGGAAGAGAGG + Intergenic
911840535 1:102675974-102675996 CAGAGGCTGAGGAAGAAAAACGG - Intergenic
912116132 1:106411550-106411572 CAGTGGGTGAATAGGACGTAAGG + Intergenic
912163724 1:107017778-107017800 CAGAGGCTGAGGCAGAAGAATGG - Intergenic
912449450 1:109760248-109760270 GGGTGAGTGAGGAGGAAGACTGG - Intronic
912551818 1:110489823-110489845 CGGGGGTGGAGGAGGAAGAAGGG - Intergenic
912729796 1:112092020-112092042 CAATTGGGGTGGAGGAAGAAGGG + Intergenic
912762536 1:112381997-112382019 TGGTGGGTGAGGGGAAAGAAGGG + Intergenic
912777275 1:112513610-112513632 AAGTGGGTGAGGAGAAGGGAGGG - Intronic
912829881 1:112943348-112943370 CAGTGAGTGGAAAGGAAGAATGG + Intronic
913324557 1:117615410-117615432 AAGTGGGGGAGTAGGAGGAATGG + Intronic
914238322 1:145832668-145832690 CCGAGAGTGAGAAGGAAGAAGGG + Intronic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
915073805 1:153293077-153293099 CAGAGGGTAAGGGGGAAGGATGG + Intergenic
915247578 1:154567667-154567689 GTGTGCGTGAGGTGGAAGAAGGG - Intergenic
915298833 1:154940643-154940665 AACTGGGTGAAGAGGAAGAAAGG - Intergenic
915446475 1:155977510-155977532 CGCTGGGGGAGGAGGAGGAAGGG + Intronic
915460252 1:156066177-156066199 AAGTGGGGGAGGAGGAGGCAAGG + Intronic
915467288 1:156105047-156105069 CACTGGGGGAGGAGGATGAGAGG - Intronic
915527024 1:156482241-156482263 CAGGGTCTGAGGAGGAAGGAAGG - Intronic
915562107 1:156693377-156693399 GAGGGGAGGAGGAGGAAGAAAGG - Intergenic
915924020 1:160002541-160002563 GTGAGGGTGAGGGGGAAGAAGGG - Intergenic
916107423 1:161441766-161441788 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916109008 1:161449184-161449206 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916110595 1:161456565-161456587 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916112181 1:161463975-161463997 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916113768 1:161471356-161471378 CGGCGGGTGGGCAGGAAGAACGG - Intergenic
916239045 1:162621209-162621231 AACAGGGAGAGGAGGAAGAAGGG + Intergenic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916711822 1:167417456-167417478 AAGTGGATGAAGAGGAATAAGGG + Exonic
916802045 1:168225159-168225181 GCGAGGCTGAGGAGGAAGAATGG - Intergenic
916865766 1:168856426-168856448 CCAGGGGTTAGGAGGAAGAAAGG + Intergenic
917078677 1:171234418-171234440 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
917127097 1:171696653-171696675 CAGTGGTTGAGGAGGAGGAAGGG + Intergenic
917621107 1:176796881-176796903 GAGTGGGAGGGAAGGAAGAAAGG - Intronic
917663463 1:177200467-177200489 GAGTGGGAGAGCAGGAGGAATGG - Intronic
918383797 1:183984760-183984782 CAGCTGGAGAAGAGGAAGAAGGG - Intronic
919072476 1:192773436-192773458 TATTGGGAGAGGAGGAGGAAAGG - Intergenic
919393950 1:197021974-197021996 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
919484845 1:198133271-198133293 CGGAGGCTGAGGTGGAAGAATGG + Intergenic
919595836 1:199561480-199561502 AAGAGGAGGAGGAGGAAGAAAGG - Intergenic
919608061 1:199710639-199710661 CAGTGAGGGAGGAGGATGGAGGG + Intergenic
920429857 1:205911525-205911547 CAGTGGGTTTGGAAGATGAAAGG + Intergenic
920567201 1:206983660-206983682 GGGTGGGTGAGGGGGAAAAAAGG - Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
920861352 1:209710051-209710073 CAGTGGGGTAGGAGAAAGAATGG + Intronic
921623019 1:217347168-217347190 AAGAGGTGGAGGAGGAAGAAAGG - Intergenic
921871937 1:220150671-220150693 CCGTGCTTGAGGAGGAAGAATGG - Exonic
922016293 1:221651296-221651318 CAGAGGCTGAGGTGGAAGGATGG + Intergenic
922176691 1:223202775-223202797 CAGTGGGTAAGTGTGAAGAATGG + Intergenic
922502567 1:226108251-226108273 CAGAGGCTGAGGTGGGAGAATGG - Intergenic
922858736 1:228797263-228797285 CCATGGGTGAGGATGAAGTAAGG - Intergenic
923220526 1:231888631-231888653 CGGTGGCTGAGGTGGGAGAATGG + Intronic
923419934 1:233802819-233802841 CAGTGGGAGAGGAGGAGAAGGGG + Intergenic
924146213 1:241077522-241077544 CAGTGGAAGGGGAGGAAAAAGGG + Intronic
924152149 1:241140358-241140380 CAGTGGGTGGAGAAGAATAAGGG - Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924484436 1:244466901-244466923 CACTGCCTGAGGAAGAAGAATGG + Intronic
924616436 1:245615704-245615726 CAGTGGATGAGAACAAAGAAGGG + Intronic
924642544 1:245848207-245848229 CAGAGGCTGAGGTGGAAGGAAGG - Intronic
1062815516 10:497017-497039 CAGAGGCTGAGGCAGAAGAATGG + Intronic
1063053210 10:2475646-2475668 CAAGGGGTCAGGAAGAAGAAGGG + Intergenic
1063110970 10:3037270-3037292 CGGTAGGTCAGGAGGCAGAAGGG + Intergenic
1063455776 10:6181899-6181921 CAGGGGCTGGGGAGGGAGAATGG + Intronic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063568242 10:7191390-7191412 CAGAGCGTGAGGTGGAAGACAGG - Intronic
1064028285 10:11866778-11866800 CAGCAGGTGAGGGGGAAGACAGG + Exonic
1064150077 10:12855555-12855577 CAGTGAGAGAGGAGGAGGACTGG - Intergenic
1064286798 10:13998671-13998693 GATTGGGTGTGGAGGGAGAAAGG - Intronic
1064409651 10:15093699-15093721 TAGGGGGTGCGGAGAAAGAAGGG - Intergenic
1064452222 10:15452958-15452980 CATTGGTGGAGGAAGAAGAATGG + Intergenic
1065707148 10:28480817-28480839 GAGCAGGTGCGGAGGAAGAATGG - Intergenic
1065793025 10:29279022-29279044 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1066325628 10:34355006-34355028 CAGTGGGAGAGGGGAAAGAGGGG + Intronic
1066703803 10:38156815-38156837 CAGAGGGTGAGGAGGAGGTCGGG + Intergenic
1067222453 10:44353773-44353795 CATCGGGTGTGGAGGTAGAAAGG - Intergenic
1067284766 10:44899469-44899491 CAGAGTGTGTGGAGGAAGGATGG + Intergenic
1067452112 10:46388190-46388212 CAGTGGGTGAGAAGGAATTAAGG + Intronic
1067471547 10:46541670-46541692 CCCTGGGAGAGGAGGAGGAAAGG + Intergenic
1067585125 10:47471565-47471587 CAGTGGGTGAGAAGGAATTAAGG - Intronic
1067596427 10:47562809-47562831 CAGTGGGTGAGGAGAATAACAGG + Intergenic
1067660543 10:48233782-48233804 CACTGTGTGGGGAGGATGAAGGG - Intronic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1068903160 10:62292713-62292735 CAGAAAGTGAAGAGGAAGAAAGG + Intergenic
1068959390 10:62851389-62851411 CAGAGGGAGAGAAGGAAGAAGGG - Intronic
1069180022 10:65347312-65347334 CAGAGGAGGAGGAAGAAGAAAGG + Intergenic
1069538151 10:69270963-69270985 CATTGGGTGAGGAAGAAGAATGG - Intronic
1069640578 10:69952879-69952901 CAGGGGGAGAGGGGGAAGAAAGG + Exonic
1069855827 10:71440523-71440545 AACTAGGTGAGCAGGAAGAAAGG + Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070356625 10:75646336-75646358 CAGAGAGGGAGGTGGAAGAAGGG - Intronic
1070630474 10:78081165-78081187 CTGGGGGGCAGGAGGAAGAATGG + Intergenic
1070665261 10:78338142-78338164 CAGGGGTTGTGGAAGAAGAATGG - Intergenic
1070712672 10:78694050-78694072 CAGGGCCTGAGGAGGAAGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070900819 10:80027479-80027501 TAATGGGTGAGTAGGAATAATGG - Intergenic
1070901528 10:80033996-80034018 TAATGGGTGAGTAGGAATAATGG - Intergenic
1071616034 10:87077428-87077450 CAGTGGGTGAGGAGAATAACAGG - Intronic
1072148770 10:92667813-92667835 GAGGGGGGGAGGAGGAGGAAGGG + Intergenic
1072801406 10:98394763-98394785 CAGTGAGAGAGAAGGGAGAATGG + Intronic
1072897181 10:99376997-99377019 GGATGGGTGGGGAGGAAGAAGGG - Intronic
1072960054 10:99921231-99921253 CAGTAGGTGAGCAGAAAGGATGG - Intronic
1073048672 10:100654424-100654446 GAGAGGGAGAGGAGGAAGGAGGG - Intergenic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073192331 10:101660514-101660536 CAGTGGGTGATGAGGCAGAGAGG - Intronic
1073284439 10:102379210-102379232 CAGTGAGTGGGGAGGGGGAAAGG + Intronic
1073376672 10:103041180-103041202 GGGTGGGTGAGGCGGAAGACGGG - Intronic
1073496609 10:103897324-103897346 GATTAGGTAAGGAGGAAGAAGGG + Intronic
1073597796 10:104817606-104817628 AGGAGGGAGAGGAGGAAGAAGGG - Intronic
1073615362 10:104989766-104989788 CAGTGGAAGAGGAGGCACAATGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074013479 10:109508245-109508267 CAGGAGGTGAGGATGAAGAGGGG + Intergenic
1074239213 10:111620573-111620595 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1074763853 10:116686526-116686548 GAGTTGGTGTGAAGGAAGAAAGG + Intronic
1075245136 10:120814881-120814903 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1075586036 10:123658911-123658933 CAGAGGCTGAGGTGGGAGAATGG + Intergenic
1076067426 10:127459827-127459849 CTGTGGGTGAGAGGGGAGAAAGG + Intergenic
1076103456 10:127801468-127801490 CAGTGGGAGAGGACGCATAAAGG - Intergenic
1076187512 10:128460844-128460866 CAGGGGGTGAGGTGGCAGCAGGG - Intergenic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1077376921 11:2209507-2209529 CAGGGGGTGAGGAGGCAGTCTGG - Intergenic
1077419756 11:2444778-2444800 CAGGGGGTGAGGCGGAGGCAGGG + Intronic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077902130 11:6498031-6498053 AATGGGGTTAGGAGGAAGAAAGG - Exonic
1077922028 11:6648511-6648533 CAGTGGGAAATGAGAAAGAATGG + Intronic
1078622001 11:12916849-12916871 ATGTGGGTGAGGAGGAGGAGAGG + Intronic
1078638002 11:13069679-13069701 CAGGGGGTGGGGAGGAAGAAAGG + Intergenic
1078846600 11:15124298-15124320 CAGGGTGTCAGCAGGAAGAATGG + Intronic
1079080508 11:17410499-17410521 GACTGGGTGAGGGGGAACAAGGG - Exonic
1079871239 11:25800872-25800894 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1080061203 11:27958749-27958771 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1080119575 11:28661657-28661679 AAGTGGGTGAGGGAAAAGAAAGG + Intergenic
1080614175 11:33931750-33931772 CAGAGGGTGAACAGGAAGGAAGG - Intergenic
1081141468 11:39506288-39506310 CAGAAAGTGAAGAGGAAGAAAGG + Intergenic
1081416429 11:42821524-42821546 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
1081601635 11:44499517-44499539 CGGAGGCTGAGGCGGAAGAATGG - Intergenic
1081852690 11:46284879-46284901 GAGTGGGTGAGGATGAAGACAGG - Intronic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1081874457 11:46399177-46399199 CGGAGGCTGAGGCGGAAGAATGG - Intronic
1081915994 11:46730530-46730552 CAGTGGGTGAGGGGAGAGAGGGG + Intronic
1081962779 11:47150638-47150660 CGGTAGGTGAGGAGGAGGCATGG + Intronic
1082175736 11:49056815-49056837 CAGAGAGTGAGGAGGAACTAGGG + Intronic
1082257910 11:50052569-50052591 CAGAGGCTGAGGCAGAAGAATGG + Intergenic
1082663496 11:55945242-55945264 CAGGGGCTGAGGTGGGAGAATGG - Intergenic
1082683230 11:56205617-56205639 CAGCAGGTGGGGAGGATGAAAGG - Intergenic
1082902209 11:58267236-58267258 GAGGTGGTGATGAGGAAGAAAGG + Exonic
1082909183 11:58350930-58350952 CTGTGGGTGAGTAGGAAGCCTGG + Intergenic
1082975755 11:59070205-59070227 CAGGGAGTGTGGAGGAAGCAAGG - Intergenic
1083050604 11:59772946-59772968 CAGGGGGTGAGGGGTGAGAAAGG - Intronic
1083777088 11:64899376-64899398 CAGCGGGTGTGCAGGAAGAGGGG - Intronic
1083875393 11:65521269-65521291 CAGAGGCTGAGGCAGAAGAATGG - Intergenic
1083882269 11:65554436-65554458 CAGTGGGTGGCAAGGAAGTAGGG - Intronic
1083910399 11:65705292-65705314 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1084058849 11:66656239-66656261 CAGAGGCTGAGGTGGGAGAATGG - Intronic
1084235324 11:67784526-67784548 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
1084596972 11:70122785-70122807 CAGAGAGTGAGGAGGAGGGAAGG - Intronic
1085084842 11:73660334-73660356 CAGGGGTTGGGGAGGAAGGAAGG - Intronic
1085099729 11:73790487-73790509 CAGAGGCTGAGGCAGAAGAATGG - Intronic
1085122981 11:73979221-73979243 CATTGGGAGAGAAGGAAGAGTGG + Intronic
1085200296 11:74697757-74697779 AGGAGGGAGAGGAGGAAGAAAGG + Intronic
1085282963 11:75342683-75342705 CTGAGGATGAGGATGAAGAATGG + Intronic
1085310431 11:75513497-75513519 CAGTCTGTGAGGAGGAAGTGTGG - Intronic
1085554678 11:77409788-77409810 AAGGGAGTGAGGAGGATGAAGGG + Intronic
1085676529 11:78525127-78525149 CAGTGGTTAGGAAGGAAGAATGG + Intronic
1086068173 11:82768662-82768684 CAATGGGTCAGGATGAAGAAGGG + Intergenic
1086669671 11:89531705-89531727 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1086994447 11:93340379-93340401 CAGTTAGAGAGGAGGAAGCAAGG + Intronic
1087660128 11:100977543-100977565 AAGTGGGTGAAGAAGAACAATGG + Intronic
1088139242 11:106595638-106595660 CTCTGGGGGAGGTGGAAGAAAGG + Intergenic
1088262046 11:107953498-107953520 CAGGGGGTGAGCAGGCAGAAAGG - Intronic
1088351264 11:108890963-108890985 CAGAGGGAGAGCAGGGAGAAAGG - Intronic
1088621537 11:111689385-111689407 ATGTGGGTGAGGTGGAAGACAGG + Intronic
1088649128 11:111941919-111941941 GAGTGAGTGAGGAAGAAGATTGG + Intronic
1088666557 11:112099509-112099531 CAGAGGCTGAGGTGGGAGAATGG - Intronic
1088755484 11:112881977-112881999 CAGTGGGGGAGACGGAAGTAAGG + Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088821937 11:113464007-113464029 CACTGGGTGCAGAGGAACAATGG + Intronic
1089247494 11:117132935-117132957 CAGAGACTGAGGAGGAGGAAAGG - Intergenic
1089337972 11:117738466-117738488 TAGCTGGTGAGGAGGAAGCATGG - Intronic
1089634477 11:119803556-119803578 CAGTGGGCGAGCAGGAGGAATGG + Intergenic
1089701885 11:120249702-120249724 CAGAGGGTCAGGAGGAAGGAGGG + Intronic
1090204108 11:124875434-124875456 GAGTGGGTGGGAAGGAGGAATGG + Intronic
1090314672 11:125775109-125775131 CAGTGGATTAAGAGGAAAAAAGG - Intergenic
1090527920 11:127557266-127557288 CAGTGTGTGAGGAAGTAGAGGGG + Intergenic
1090589119 11:128246490-128246512 CAGTGGGGGAGGAGGGAGCGGGG - Intergenic
1090799854 11:130163611-130163633 CAGTGGGTGAGGAAGAGGGTTGG + Intronic
1091075180 11:132608857-132608879 CAGTGGAGCAGGAGGAAGCAAGG - Intronic
1091130396 11:133141870-133141892 CAGAGCGTGAGAAGGAAGAATGG - Intronic
1091294080 11:134460278-134460300 CTGGGGGTGGGGAGGAACAAAGG + Intergenic
1091372594 11:135073300-135073322 CAGAGGGTGAGAAGCGAGAAGGG + Intergenic
1091425824 12:388885-388907 GAGAGGGGGAGAAGGAAGAATGG - Intronic
1091459299 12:631755-631777 TATGGGGTGAGGAGCAAGAAAGG - Intronic
1091603168 12:1930035-1930057 GAGAGGGCGAGGAGGAAGAGGGG + Intergenic
1091714211 12:2765525-2765547 CAGTGACTGAGGAGGAAAGAGGG + Intergenic
1092598411 12:10032493-10032515 GAGAGGCTGAGGCGGAAGAATGG - Intronic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093409525 12:18847655-18847677 CAGTGGGAGAAGAGATAGAAAGG + Intergenic
1093692620 12:22125181-22125203 CAGAGGCTTAGGAGGAAAAATGG + Intronic
1093928757 12:24934274-24934296 CAGAAGGTGAAGAGGAAGCAAGG - Intronic
1094083809 12:26566382-26566404 CAGAGGGAGAGGAGAAGGAAAGG + Intronic
1094107951 12:26833253-26833275 CATTGGGCGAGGAGGAGGAGAGG + Intergenic
1095599956 12:44002738-44002760 CACTGGTAGAGAAGGAAGAAGGG - Intronic
1096188480 12:49599383-49599405 CAGTGGGAGAGAAGGAACACAGG - Intronic
1096229818 12:49890626-49890648 GAGTGGGGATGGAGGAAGAAGGG - Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1096813384 12:54185876-54185898 AAATGGGAGAGGAAGAAGAAAGG + Intronic
1097613902 12:61861053-61861075 CAGAGGTTGAGGTGGAAGAATGG - Intronic
1097629912 12:62048250-62048272 CAGAAGGTGAAGAGGAAGTAAGG + Intronic
1098042088 12:66362505-66362527 CAGTGGAGGAGGAGGACGATAGG + Intronic
1098458122 12:70699841-70699863 CAGAAGGTGAGAAGGAAGAAGGG - Intronic
1098523534 12:71460749-71460771 ATGTAGGAGAGGAGGAAGAATGG - Intronic
1098542374 12:71671041-71671063 CTGAGGAGGAGGAGGAAGAAGGG + Intronic
1098836237 12:75427836-75427858 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1099182736 12:79486360-79486382 TAGTGGGTGGGGATGAAGAGCGG - Intergenic
1099186797 12:79523756-79523778 CAGTAGGAAGGGAGGAAGAAGGG - Intergenic
1099285549 12:80710460-80710482 CTGTTGGGGAGGAGGAGGAAAGG - Intergenic
1099713293 12:86257242-86257264 CAGTGGGAGAGGAGGATAATGGG + Intronic
1099824778 12:87761198-87761220 CAATGGGTGAGGAAGTAGCATGG + Intergenic
1100432688 12:94544843-94544865 AAGTGGGTGGGGGGCAAGAATGG + Intergenic
1100433442 12:94550950-94550972 CAGAGGGTGTGTAGGAAGGACGG + Intergenic
1100761858 12:97816168-97816190 CAGAAGGTGAGGGGGAAGTAAGG - Intergenic
1101063591 12:100996692-100996714 CAGTGGGGCAGGGAGAAGAATGG + Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101259057 12:103010687-103010709 CAGTGTGTGAGGATGAGGCAGGG - Intergenic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1102562007 12:113769121-113769143 CGGTGGGGGAGGATGAAGGAAGG - Intergenic
1102904376 12:116662874-116662896 AAGAGGGGGAGGAGGAAGGACGG - Intergenic
1103080928 12:118023434-118023456 GAGGGGGTGAGGAGGAGGAGGGG + Intronic
1103185030 12:118949282-118949304 CAGAGGAAGAGGAGAAAGAAGGG - Intergenic
1103398034 12:120622979-120623001 AAGTGGGTGAGCAGGAAGATAGG - Intergenic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1103902274 12:124309457-124309479 CAGTGGGTGAGCTGAACGAAAGG + Intronic
1104035906 12:125096958-125096980 AAGTGGCTGGGGAGGAGGAAGGG + Intronic
1104280972 12:127376780-127376802 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
1104402274 12:128485866-128485888 TAGAGGAGGAGGAGGAAGAAGGG - Intronic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1104803458 12:131570218-131570240 AGGTGGGTGAGGTGGAAGAGGGG + Intergenic
1105490505 13:20883257-20883279 CAATGGGTGAGGAGAAAGAAAGG + Intronic
1105543344 13:21333842-21333864 CAGTGGCTGAGGAGGAAGACAGG - Intergenic
1105771296 13:23614615-23614637 CAGTGGCTTAAGAGCAAGAAGGG - Intronic
1107277974 13:38698496-38698518 CTGTGGGTGAGGAGAAAAACTGG + Intronic
1107323083 13:39210075-39210097 AATTGTGAGAGGAGGAAGAAAGG - Intergenic
1107739658 13:43435837-43435859 CTGTGGTTGAGGCAGAAGAAAGG + Intronic
1107869629 13:44734936-44734958 CAGTGGGTCAGTGGGAAGAGGGG - Intergenic
1107932286 13:45316250-45316272 CAGAGGAAGAGGAGGAAGAGGGG + Intergenic
1108805123 13:54145250-54145272 CAGGCGGTCAGGAGGAACAAAGG - Intergenic
1109879278 13:68450554-68450576 CAGAGGTTTAGGAGGAAAAATGG + Intergenic
1109881812 13:68487839-68487861 AAGTGGGTGGGGAAGGAGAAAGG - Intergenic
1110633764 13:77740855-77740877 CAGTGGAGGAGGAGGAGGACAGG - Intronic
1110673179 13:78206630-78206652 CAGTGGTTGAGAAGAAGGAAAGG - Intergenic
1110841364 13:80147308-80147330 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1110967411 13:81716925-81716947 AAGAGGGTGAGGAGGAATGAAGG - Intergenic
1111492514 13:89000337-89000359 CTGAGGGTTGGGAGGAAGAAGGG - Intergenic
1111669185 13:91306569-91306591 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1111708149 13:91777102-91777124 TGGTGGGGGAGGAGGAAGAAAGG - Intronic
1112326363 13:98444949-98444971 CACTGGGGGAGGAGGATGGATGG + Intronic
1112462240 13:99613386-99613408 CAGTGTGTGAGGAAGCAGCAGGG + Intronic
1112556420 13:100472563-100472585 GTGTGGGTCAGGAGGCAGAAAGG + Intronic
1112641068 13:101275653-101275675 CTGTAGCTGGGGAGGAAGAAGGG + Intronic
1112968184 13:105225157-105225179 GAGTCGGGGAGGAGGAACAACGG - Intergenic
1113071121 13:106422617-106422639 CAGTAGGAGGCGAGGAAGAAGGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113741380 13:112714463-112714485 CGGGGAGTGAGGAGGGAGAAAGG - Intronic
1113796600 13:113061886-113061908 TAGGGGGAGAGGAGGAGGAAGGG - Intronic
1113813276 13:113154472-113154494 GTGTGGGGGAGGAGGAGGAAGGG + Intergenic
1113886708 13:113664855-113664877 CATTGGGTGAGCAGGCAGGAAGG + Intergenic
1114261435 14:21039392-21039414 CAGTGGGAGAGAAGACAGAAGGG - Intronic
1114535115 14:23417705-23417727 CAGAGGGTGGGGAGGATGGAGGG + Intronic
1114549856 14:23526486-23526508 CCATGGCTGAGGAGGAAGAGGGG - Exonic
1115051893 14:29072815-29072837 CAGAGGCTTAGGAGGAAAAATGG - Intergenic
1115496305 14:34008032-34008054 TAGTGGGAGAGGAGGAGGAGTGG - Intronic
1115697314 14:35913246-35913268 CAGAAGGTGAAGAGGAAGCAAGG - Intronic
1115710215 14:36042244-36042266 CTGTTGGTCAGAAGGAAGAATGG - Intergenic
1115730622 14:36265577-36265599 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1115834026 14:37377274-37377296 CAGTAGGGGAGGAGGAAAGAGGG + Intronic
1116347401 14:43812359-43812381 TAGAGGCTGAGGAGGAAGAATGG - Intergenic
1116472724 14:45305146-45305168 ATGTGGGTCAGGAGGAAGAGAGG + Intergenic
1116778742 14:49212453-49212475 CATTGGGTGTTGAGGAGGAATGG - Intergenic
1117147644 14:52850995-52851017 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
1117658184 14:57977889-57977911 CACTGGGTGTGGAGGAAGAAGGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118183774 14:63520138-63520160 CAGAGGCTGAGGCGGGAGAATGG - Intronic
1119055711 14:71417644-71417666 CAGAGGTGGAGGAGGAGGAAGGG + Intronic
1119072306 14:71598934-71598956 AAGTGGGGGAGGATGAAGAGAGG - Intronic
1119544112 14:75459470-75459492 GAGGTGGTGAGGAGGCAGAAAGG + Intronic
1119623633 14:76151986-76152008 CAGCTGGTGAGGGGGAGGAATGG + Exonic
1119677148 14:76564374-76564396 GACTGGGGGAGGAGGAGGAATGG + Intergenic
1119870494 14:78012649-78012671 CAGGTGGTGAAGTGGAAGAATGG + Intergenic
1119872883 14:78032021-78032043 CAGTGGGTAGAGAGAAAGAAAGG + Intergenic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120281139 14:82439343-82439365 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1120285045 14:82489314-82489336 GAGTGGGTGAAGAGGCAGAGAGG + Intergenic
1120991602 14:90382517-90382539 GAGTGGGGGAGGGGGAGGAAAGG - Intergenic
1121004175 14:90477644-90477666 TAGAGGAGGAGGAGGAAGAAGGG + Intergenic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121611798 14:95285999-95286021 AAGTGGAGGAGGAGGAGGAAGGG + Intronic
1121779173 14:96610857-96610879 CAAGGGGTGGGGAGGAAGATGGG - Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1122038531 14:98965422-98965444 AAAGGGGTGAGGAGGGAGAAGGG - Intergenic
1122438066 14:101712518-101712540 CAGTGGGTGGGGAGAAATGACGG - Intergenic
1124238137 15:28007107-28007129 AAGTGGGTGAAGGGAAAGAAAGG + Intronic
1124352100 15:28963417-28963439 AGGTGGGTGGGGAGGATGAAAGG - Intronic
1124563286 15:30794409-30794431 CACTGTGTGAGGAGGATGGAGGG - Intergenic
1124622024 15:31279243-31279265 CAGGGGGTGTGAAGGAAGCAGGG - Intergenic
1125042801 15:35211494-35211516 AAGAGGGGGAGGAGGAAGAGAGG + Intergenic
1125356040 15:38818267-38818289 CAATTGGTGAAGAGGAATAATGG + Intergenic
1125679081 15:41519683-41519705 GAATTGGTGAGGAGGTAGAAAGG - Intronic
1125765518 15:42132766-42132788 CAGCTGGTGAAGAGGAAGAGTGG + Intergenic
1126437568 15:48651473-48651495 CAGAGAATGATGAGGAAGAATGG - Intergenic
1126778252 15:52117977-52117999 CAGTGGGTGGGGTAGAAGACTGG - Exonic
1127373281 15:58359835-58359857 GACTGGGGGAGGAGGAGGAATGG - Intronic
1127586403 15:60382108-60382130 AAGAGGGAGAGAAGGAAGAAAGG + Intronic
1127922236 15:63503373-63503395 CAGAGCGAGAGGAGGAAGGAAGG - Intergenic
1127942742 15:63716327-63716349 CAGAGGATGAAGAGGAGGAACGG - Exonic
1128224061 15:65989440-65989462 CTGTGGGTGGGGTGGAAGATTGG - Intronic
1128403230 15:67307520-67307542 GAGTGGGAGTGGAGAAAGAAGGG + Intronic
1128798366 15:70480705-70480727 GAGTGGGTGAGTGGGCAGAACGG + Intergenic
1129668942 15:77596324-77596346 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
1130025603 15:80268167-80268189 AAGTGGGTGATGGAGAAGAACGG + Intergenic
1130155827 15:81349255-81349277 CAGGGGAAGAGGAGGAGGAAGGG - Intronic
1130231303 15:82099376-82099398 AAGAGGGTGAGGAGGGAGAGAGG - Intergenic
1130379265 15:83357703-83357725 GAGAGGGAGAGAAGGAAGAAAGG + Intergenic
1130443573 15:83978383-83978405 CAGTGGGAGAGGTGGAGGGATGG + Intronic
1130857486 15:87853795-87853817 CAGTGGATGAGGAGGATGTTGGG + Intergenic
1130924569 15:88375398-88375420 TAGTGGGGGAGGAGGCAGAATGG - Intergenic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131486437 15:92824747-92824769 TCGTGGGGGAGGAGGAAGGAAGG + Intergenic
1131579225 15:93625646-93625668 AAGTAGGAGAGGAGGTAGAAGGG + Intergenic
1131598667 15:93825237-93825259 CAATGGTGGAGGAGGAAGAGAGG + Intergenic
1131789019 15:95944323-95944345 TAGTGGGGGAGGAGGAATCAGGG - Intergenic
1132250591 15:100332952-100332974 CAGTGAGGGAGGAGGAGGCAGGG - Intronic
1132697852 16:1209902-1209924 CAGCGGGTGAGGAGTGAGGATGG + Intronic
1132860767 16:2070694-2070716 CAGTGGGTGCAGAGGAGGGACGG - Intronic
1133102761 16:3489229-3489251 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133537856 16:6719543-6719565 CAGAGGCTGAGGCAGAAGAATGG - Intronic
1133735757 16:8614367-8614389 CAGGAGATGGGGAGGAAGAAGGG + Intergenic
1134025438 16:10949556-10949578 CACTGGGTGAAGAGGAAGTGAGG + Intronic
1134229555 16:12418406-12418428 GAGTGGGTGAGAAGGAGAAAGGG + Intronic
1134906124 16:17981310-17981332 CAGTGGATGGGCAGGAAGGATGG - Intergenic
1135166105 16:20140556-20140578 CAGTGGGTGGGGCAGAAGGAAGG - Intergenic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1135692496 16:24553296-24553318 CAGTTGGAGGGGAGGAAGAGGGG - Intronic
1135826168 16:25730656-25730678 CAGAGGGAGAGAAGGAAGAGAGG - Intronic
1136043968 16:27601325-27601347 TACTGGGTGAGGAGGCAGACAGG + Intronic
1136242472 16:28952545-28952567 CAGTGGGGGAGGACAAAGACAGG - Intronic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136350063 16:29700994-29701016 GGGTGGGTGAGGAGGAGGACAGG - Intergenic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136480789 16:30540326-30540348 CAGAGGCTGAGGAAGGAGAATGG + Intronic
1136486569 16:30576314-30576336 CAGAGGCTGAGGCGGGAGAATGG - Intronic
1137800876 16:51260919-51260941 CTGAGGGAGAGAAGGAAGAAGGG - Intergenic
1137817240 16:51410133-51410155 CAGTGGGTGAGGGGTCTGAAGGG - Intergenic
1138236124 16:55384248-55384270 GAGGGGGTGAGCAGGAAGAAGGG - Intergenic
1138237540 16:55397632-55397654 CAGTTAGGGAGGAGGAAGAGTGG - Intronic
1138687805 16:58740956-58740978 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1139165955 16:64565671-64565693 CAGAAGGTGAAGGGGAAGAAAGG - Intergenic
1139208055 16:65048164-65048186 CAGTGAGTGAGGGGCAAAAATGG - Intronic
1139265835 16:65637440-65637462 CAGCTGATGAGGAGGAAGATGGG - Intergenic
1139284292 16:65797001-65797023 CAGTGCAAGAGGAGGAGGAAAGG - Intergenic
1139308151 16:66005739-66005761 AAGTGGGTGGGGAGCGAGAAAGG - Intergenic
1139606940 16:68025695-68025717 CTGTGAGTGAGGGGGAAAAAAGG - Intronic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1139917431 16:70437432-70437454 CAGTGGGTTGGGTGGAGGAAAGG - Intronic
1140638437 16:76943857-76943879 CAGAGGGGGAGAAGGAAGAAAGG - Intergenic
1141305945 16:82864453-82864475 CAGAAGGTGAAGAGGAAGCAAGG + Intronic
1141493549 16:84391007-84391029 GAGTGGGTGAGGCAGGAGAATGG + Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1142420882 16:89969103-89969125 CAGAGGCTGAGGCAGAAGAATGG - Intergenic
1142582052 17:949031-949053 CAGGGGGAGAGGAGGAGGCAGGG - Intronic
1142889256 17:2932361-2932383 CAGTGGAGGAGGAGGGAGACTGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143326511 17:6102035-6102057 CGCAGGGAGAGGAGGAAGAAAGG + Intronic
1143638541 17:8181510-8181532 CTGTGGGTGAGTGGGAAAAAGGG + Intergenic
1144482337 17:15638463-15638485 CAGAGGCTGAGGCGGGAGAATGG + Intronic
1144579612 17:16450945-16450967 AAGTGGGTGAGAAGGCAGGAGGG + Intronic
1144690575 17:17260071-17260093 GAGCAGGTGAAGAGGAAGAAAGG - Intronic
1144713759 17:17420372-17420394 CAGTGTGCAAGGAGGAAGCAGGG + Intergenic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144930439 17:18854837-18854859 CAATGGGTAATGAGCAAGAAAGG - Intronic
1144957492 17:19026409-19026431 CAGAGGCTGAGGCGGGAGAATGG + Intronic
1144977664 17:19148107-19148129 CAGAGGCTGAGGCGGGAGAATGG - Intronic
1145037595 17:19552136-19552158 CAGGAGGGGAGGAGGAAGAAAGG + Intronic
1145046527 17:19621806-19621828 CAGGACTTGAGGAGGAAGAATGG - Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1146001529 17:29133399-29133421 CAGTGGGTTAGGAGGACAAGGGG - Intronic
1146581304 17:34040431-34040453 CAGTGGGGGAGGAGGGGGAGGGG + Intronic
1147169086 17:38607612-38607634 CAGTGGGTGAGGAATCTGAACGG - Intergenic
1147323935 17:39661468-39661490 GACAGGGTGAGGAGGACGAAAGG - Intronic
1147347647 17:39812995-39813017 TAGAGGCTGAGGTGGAAGAATGG + Intronic
1147627240 17:41908081-41908103 CCCTGGGGGAGGAGGAAGATGGG - Intronic
1147686747 17:42290474-42290496 GAGTGGGTATGGAGGAAGAGAGG + Intronic
1148041778 17:44713142-44713164 CAGAGGCTGAGGCAGAAGAATGG - Intronic
1148110881 17:45144244-45144266 CATTGGGTGGGGAGCAGGAAAGG - Intergenic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1148615678 17:48998168-48998190 CCGTCGGTGGGGAGGAAGGATGG - Intronic
1148980923 17:51574297-51574319 CAGGTGGTGAGAAGGAGGAAGGG + Intergenic
1149930594 17:60750843-60750865 CAGTGGATAAGGAACAAGAAGGG - Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150438874 17:65175697-65175719 AAGTGGGTGGGGAGGAGGACAGG - Intronic
1151226111 17:72649391-72649413 CAGTAGGAGAGGAAGGAGAAAGG + Intronic
1151478890 17:74358627-74358649 CAGTAGGAGAGGAAAAAGAAAGG - Intronic
1151619075 17:75234154-75234176 AGGAGGCTGAGGAGGAAGAATGG - Intronic
1151697806 17:75726966-75726988 CAGAGGCTGAGGTGGGAGAATGG + Intronic
1151713123 17:75817946-75817968 TAGGGGGTGGGGAGGAAGAAGGG + Intronic
1151760963 17:76103094-76103116 CAGAAGGAGAGAAGGAAGAATGG + Intronic
1151828219 17:76535417-76535439 CAGTGGGGGAAGGGGAAGAAAGG - Intronic
1151829166 17:76539559-76539581 CATCAGGAGAGGAGGAAGAAAGG - Intronic
1152004293 17:77668905-77668927 CAGGGGGAGAGGAGAAAGAGCGG - Intergenic
1152782381 17:82232010-82232032 CAGGGGCTGCGGGGGAAGAAGGG + Intronic
1153362504 18:4213377-4213399 CATCGAGTCAGGAGGAAGAATGG + Intronic
1153538064 18:6124159-6124181 CAGAGGGACAGGACGAAGAATGG + Intronic
1153706218 18:7748401-7748423 CAGAGGAAGGGGAGGAAGAAGGG - Intronic
1154031203 18:10755904-10755926 TAGAGGGTGAGGAGGAGGGATGG + Intronic
1154370296 18:13754990-13755012 CAGTGGGTGTTGAGGAAGTCAGG + Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1156584136 18:38413300-38413322 CAGTTGGTGAGGAAGAAGAGAGG - Intergenic
1156697175 18:39781176-39781198 CAGGGGATGAGGAGGAGGAGAGG - Intergenic
1157077133 18:44478468-44478490 CAGAAGGTGATGGGGAAGAAAGG - Intergenic
1157529824 18:48410551-48410573 CAGTGCGAGGGGAGGAGGAAGGG + Intronic
1157980473 18:52373994-52374016 CAGAGGCTGAGGAAGGAGAATGG - Intronic
1158594877 18:58807271-58807293 AGGTGGGTCAGGAGGCAGAAAGG - Intergenic
1158610475 18:58935407-58935429 GAGTGGGGGAGGAGGGAGAGGGG - Intronic
1158848576 18:61470673-61470695 AACTTGGTGAAGAGGAAGAAAGG + Intronic
1159050662 18:63418512-63418534 CAGAGGCTGAGGTGGGAGAATGG - Intronic
1159079792 18:63724253-63724275 CAGAGGAGGAGGAGGAGGAAGGG - Intronic
1159215522 18:65386789-65386811 CAGTGGCCTAGGAGGAAAAATGG + Intergenic
1159571887 18:70123925-70123947 CATGGGGTGAATAGGAAGAAAGG - Intronic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1161114408 19:2488835-2488857 CAGGGGGTGAGGTGGAAGGAAGG - Intergenic
1161115265 19:2493214-2493236 CAGAGGCTGGGGAGGAAGATCGG - Intergenic
1161234207 19:3189986-3190008 GAGTGAGCGAGGAGGGAGAAGGG - Intronic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1161431472 19:4234819-4234841 CACCGGGTGAGGAGGATGAGGGG + Exonic
1161497191 19:4593049-4593071 GAGTGGGAGAGAAGGAAGACTGG + Intergenic
1161649876 19:5477929-5477951 GAGGGGGTGAGGAGGAGGAGAGG - Intergenic
1161803497 19:6429341-6429363 AAGAGGGAGAGGAGGGAGAAAGG + Intronic
1161866038 19:6832746-6832768 AAGTGGAAGAGGAGGAAGAGGGG - Intronic
1162054118 19:8052668-8052690 CAGGTGGAGAGGAGGAGGAAGGG + Intronic
1162400230 19:10441494-10441516 CAGAGGCTGAGGTGGAAGGATGG - Intronic
1162440064 19:10687310-10687332 CAGTGGGTCAGGCGGAGGACGGG - Intronic
1162752421 19:12836907-12836929 CACAGGGTGAGGTGGAAGGAAGG - Intronic
1162839571 19:13346239-13346261 GAGTGAGTGAGGATGAAGGAAGG - Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163034105 19:14561641-14561663 AAGTGGGTGGGGAGGAAGGTTGG + Intronic
1163083234 19:14958672-14958694 CAGGGGATGAGGTGGAAGGATGG - Intronic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1163347946 19:16756355-16756377 CAGAGGAAGAGGAGGAAGAGGGG + Intronic
1163890384 19:20007495-20007517 CTGTGGTTGAAGAGGAAGATGGG + Intronic
1163954274 19:20620941-20620963 CAGAGGCTGAGGCGGGAGAATGG - Exonic
1164292717 19:23881935-23881957 CGGAGGAAGAGGAGGAAGAAAGG + Intergenic
1164474433 19:28564242-28564264 AAGTGGGAGAGGAGGTAGACAGG - Intergenic
1164592088 19:29512732-29512754 GAGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165445886 19:35856641-35856663 CAAGGGGTGAGGAGGAGGGAAGG - Intronic
1165633957 19:37324877-37324899 CAGGGGCTGAGGTGGGAGAATGG - Intronic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1165885705 19:39076710-39076732 CAGGGGGTGAGGAGGGGGACAGG + Intergenic
1165894997 19:39136212-39136234 CAGTGGGGGAGAAGGGAGCAGGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166211155 19:41307410-41307432 CAGTGGGTGAGAGGGAAGAAGGG + Intronic
1166297443 19:41896016-41896038 GAGAGGGTGGGGAGGATGAATGG + Intronic
1166318434 19:42002015-42002037 AAGTGGGAGAAGGGGAAGAAGGG + Intronic
1166360446 19:42250880-42250902 CAGTGGGGGAGGGGCAGGAAGGG + Intronic
1166390600 19:42407013-42407035 AAGTGGCTGAGGTGGAAGATTGG + Intronic
1166428661 19:42702742-42702764 CAGAGGCTGAGGCAGAAGAATGG - Intronic
1167035115 19:46990581-46990603 CAGAGGGTGGGGAAGAGGAAAGG + Intronic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167608178 19:50492838-50492860 AAGAGGGAGAGGAGGAGGAAAGG + Intergenic
1168019256 19:53596849-53596871 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
1168102497 19:54148534-54148556 CAGTGAGTGAGGAGGCAGCGGGG + Exonic
1168115139 19:54218143-54218165 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168120836 19:54251835-54251857 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168124414 19:54275732-54275754 CAGAGGATGAGGAGCAGGAAGGG + Intronic
1168177571 19:54635806-54635828 CAGAGGATGAGGAGCAGGAAGGG - Intronic
1168181853 19:54666946-54666968 CAGAGGATGAGGAGCAGGAAGGG - Intronic
925531013 2:4862575-4862597 CAATGAGTGAAGATGAAGAAAGG - Intergenic
926305909 2:11637112-11637134 CAGTGGGTGAAGGTGCAGAAGGG + Intronic
926612344 2:14958945-14958967 CAGTGGGAAAGGAGGAAGGGTGG + Intergenic
926622634 2:15060644-15060666 GAGTCGGGGAGGGGGAAGAAGGG + Intergenic
926902115 2:17763519-17763541 CAGTGGATTAGGAGGAAGCAGGG - Intronic
927086797 2:19680053-19680075 CAATGAATGGGGAGGAAGAATGG - Intergenic
927136437 2:20100049-20100071 CAGTGGCTGAGCAGGAAGATGGG - Intergenic
927564695 2:24101785-24101807 AAGAGGCTGAGGTGGAAGAATGG - Intronic
927651059 2:24914049-24914071 GGCTGGGTGAGGAGGAAGGAGGG - Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928108876 2:28490509-28490531 AAGAGGGAGAGGAGAAAGAAAGG + Intronic
928287345 2:30004439-30004461 GTGGGGGTGAGGAGGAAAAAAGG - Intergenic
928387886 2:30885062-30885084 AAGTGTGTGAGAAGGAAGTAAGG - Intergenic
928508501 2:31979082-31979104 CAGAAGGTGAGGGGGAAGCAAGG + Intronic
928538034 2:32258779-32258801 CAGAGTGTGTGGAGGAGGAAGGG - Intronic
929164859 2:38871809-38871831 CAGAGGCTGAGGTGGAAGAATGG - Intronic
929227694 2:39527376-39527398 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
929659558 2:43770211-43770233 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
929890594 2:45915830-45915852 CAGTGGGAGAGGAGGATGCTTGG - Intronic
930117431 2:47730648-47730670 GGGAGGGTGAGGTGGAAGAATGG - Intronic
930231034 2:48843976-48843998 CACTGGGGTAGGAGGAAGGATGG + Intergenic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
931615115 2:64147938-64147960 CAGAGGCTGAGGCAGAAGAATGG - Intergenic
931992796 2:67807891-67807913 AAGTGGAGGAGGAGGAAGAAGGG - Intergenic
932344710 2:70988063-70988085 CAGAAGGTTAGCAGGAAGAAAGG + Exonic
932748121 2:74352113-74352135 CAGAGGCTGAGGCAGAAGAATGG - Intronic
933114134 2:78445650-78445672 CTGAGGCTGAGGTGGAAGAATGG - Intergenic
933253492 2:80054923-80054945 GAGGGGGTGAGTGGGAAGAATGG + Intronic
933367531 2:81372821-81372843 AATTGGTTGAGGAGAAAGAATGG - Intergenic
933573499 2:84040620-84040642 GGGTGGGTGAGGAGGCAGCATGG + Intergenic
933761496 2:85675350-85675372 CAGAGGGAGGGAAGGAAGAAAGG + Intergenic
933780893 2:85800162-85800184 CAGTGAGTGTGGAGGCAGAGAGG - Intergenic
934527728 2:95062026-95062048 CCGTGGCTGGGGAGGAAGGAAGG - Intergenic
934782177 2:96977691-96977713 CAATGGGGGAGGGGGAAGGAGGG + Intronic
935272268 2:101445179-101445201 CAGTGGGTGAGCAGGAGGGTGGG - Intronic
935427875 2:102940191-102940213 CAATGTGTGTGCAGGAAGAATGG - Intergenic
935747010 2:106197246-106197268 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936937357 2:117851207-117851229 CAGTGGGTGAGGAAGAAAGATGG + Intergenic
937206207 2:120238696-120238718 CAGTGGGGCAGGAGGAGGACAGG + Intergenic
937559677 2:123206284-123206306 CAGGGGGTATGGAGGAGGAATGG + Intergenic
937686438 2:124703170-124703192 AAGAAGGAGAGGAGGAAGAAAGG - Intronic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
938670312 2:133580225-133580247 CAGAGAGTCAGGAGGTAGAATGG - Intergenic
938828347 2:135029269-135029291 CAGAGGCTGAGGTGGGAGAATGG + Intronic
938931808 2:136093153-136093175 CAGTGGGTGAGTGAAAAGAAAGG + Intergenic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939081568 2:137668893-137668915 CTGAGGAGGAGGAGGAAGAAAGG + Intronic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940660104 2:156534995-156535017 CAGTGGGGGAGGAAGATGACAGG + Intronic
940851393 2:158690862-158690884 CAGTGCTTGAGGTGGAAGCATGG - Intergenic
941303553 2:163832041-163832063 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
941538865 2:166757585-166757607 GAGAGGCTGAGGAGGAAGAATGG + Intergenic
942571867 2:177323175-177323197 CAGTGGAGGAGGAGGGAGCAGGG - Intronic
942876385 2:180804785-180804807 CTCTGGCTAAGGAGGAAGAAAGG + Intergenic
943489058 2:188527058-188527080 AAGGGAGTGGGGAGGAAGAAAGG - Intronic
943694434 2:190909464-190909486 AAGTGGGGGAGGGGGGAGAAGGG - Intronic
944051418 2:195474363-195474385 GAGTGGGAGGGAAGGAAGAAGGG + Intergenic
944365458 2:198913748-198913770 CAGTGGGTGATGGGGAGGAAGGG + Intergenic
944401119 2:199327731-199327753 AAGTGTGTGGAGAGGAAGAATGG + Intronic
945470324 2:210221831-210221853 CAGAGGCTGAGGCAGAAGAATGG - Intronic
946312127 2:218888133-218888155 CAGTGGGTGAGGATTAAGGTGGG + Intronic
946440194 2:219688515-219688537 CAGAAGGTGAGGGGGAAGCAAGG - Intergenic
946549822 2:220789048-220789070 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
946603386 2:221375168-221375190 CTGAGTGTGAGGAGGAAGAAAGG + Intergenic
946717512 2:222568178-222568200 CAGGGAATCAGGAGGAAGAAAGG + Intergenic
946764066 2:223023822-223023844 CAGTGGTTGAGGAGGGGCAATGG + Intergenic
946907552 2:224431008-224431030 CAGTGGGTGATGGGGAAGGTGGG - Intergenic
947388887 2:229620138-229620160 CTGTGGGTGTCGCGGAAGAACGG + Intronic
947523904 2:230867013-230867035 TGCTGGGTGAGGGGGAAGAAAGG - Intronic
947647402 2:231753444-231753466 CGGAGGGTGAGGCGGGAGAATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948773047 2:240261874-240261896 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168876000 20:1172692-1172714 TGGTGGGTGAGGGGGAGGAAGGG + Intronic
1169210605 20:3764403-3764425 CAGTAGGTTGGGAGGAAGACAGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169506053 20:6213029-6213051 CAATGGGTGAGGAGCGAGGAAGG + Intergenic
1169525976 20:6426196-6426218 GAGTGGGAGAGGAGGAGGAAGGG - Intergenic
1169902981 20:10571589-10571611 CAGAGGGTGAGCAGGGAGAGAGG - Intronic
1169912856 20:10661405-10661427 GAGTGGCTGAGGGTGAAGAAAGG + Intronic
1170447270 20:16441258-16441280 CCGTGGGTGAGAAACAAGAACGG - Intronic
1170501867 20:16982613-16982635 AAGTGGGGAGGGAGGAAGAAGGG - Intergenic
1170747281 20:19111459-19111481 CAGTGGGTGGGGAGAGAGGAAGG + Intergenic
1171016561 20:21547413-21547435 CAGGGGCTGGGGAGGGAGAATGG + Intergenic
1171035097 20:21707646-21707668 AAGTGGGTGACGAGGAAGATGGG + Intronic
1171057506 20:21921442-21921464 AAGTGGGTGGGGAGGTGGAAGGG + Intergenic
1171399074 20:24860011-24860033 CAGAGGGTGAGGAAGAGGAACGG - Intergenic
1172009647 20:31839012-31839034 GAGTGAGTGAGGGGGAAGGAAGG + Intergenic
1172489734 20:35326239-35326261 GAGTAGATGAGGAGGAGGAAAGG + Intronic
1173001995 20:39111497-39111519 CAGTGGAGCAGGAGGAAGAAGGG + Intergenic
1173145164 20:40518594-40518616 CACTGCTTGAGGAGAAAGAATGG + Intergenic
1173457209 20:43212949-43212971 GAGAGGGAGAGAAGGAAGAAAGG + Intergenic
1173951569 20:46997570-46997592 CCCTGGGGGAGGATGAAGAAGGG + Intronic
1173952263 20:47002681-47002703 GAATGGTAGAGGAGGAAGAAAGG - Intronic
1174044547 20:47724242-47724264 CTGTGGGTGGGGAGAAGGAATGG + Intronic
1174256225 20:49257633-49257655 AAGGGGATGAGGAGGAAGAAGGG - Exonic
1174471794 20:50767008-50767030 CAGAGGGTGAGGGGGAGGCAGGG + Intergenic
1174500192 20:50978674-50978696 AAGAGGAGGAGGAGGAAGAAAGG - Intergenic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1175163644 20:57027631-57027653 CAGTGAGGAAGAAGGAAGAATGG + Intergenic
1175332999 20:58177611-58177633 CACTTGGTGAGGGGGAAGGAGGG - Intergenic
1175700619 20:61134327-61134349 CAGCAGGAAAGGAGGAAGAATGG - Intergenic
1175746962 20:61463802-61463824 CACTGGGTGAGCTGGCAGAAAGG + Intronic
1175786094 20:61712562-61712584 GAGAAGGGGAGGAGGAAGAAAGG - Intronic
1175844425 20:62051164-62051186 CTGGGGCTGAGGAGCAAGAAGGG + Intronic
1175921385 20:62451979-62452001 AAGAGGGAGAGGAGGGAGAAGGG + Intergenic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1177113949 21:17063169-17063191 CAGTGGGATAGGAGACAGAAAGG + Intergenic
1177877929 21:26657421-26657443 CAGAGGTGGAGGAGGTAGAAGGG - Intergenic
1178000431 21:28156463-28156485 CTGAGGAGGAGGAGGAAGAAAGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178336733 21:31750110-31750132 CAGTGGGTAGGGAGAAGGAAGGG - Intergenic
1178709688 21:34905150-34905172 CAGTGGGTGAATTGGGAGAAGGG - Intronic
1179313024 21:40213664-40213686 GAGTGGGTGAGAAGCTAGAAGGG + Intronic
1179445413 21:41426940-41426962 GAGTGGGTGCGGTGGACGAAGGG + Intronic
1179904948 21:44418027-44418049 AGGTGGCTGAGGAGGATGAAGGG - Exonic
1179956006 21:44738983-44739005 CAGTGAGAGAGGAGCAAGAAAGG + Intergenic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1181531387 22:23519361-23519383 CAGGAGGTGAGCAGGAAGAGCGG + Intergenic
1182051042 22:27313096-27313118 GTGTGGGGGAGGAGGAGGAAAGG + Intergenic
1182281189 22:29218604-29218626 CAATGGGTGAGGAAGAACCAAGG + Intronic
1182371111 22:29811677-29811699 CTCAGGGTGAGGAGGAAGAAAGG - Intronic
1182422149 22:30253868-30253890 CACTGGGTGGGGAGGATGGAGGG + Intergenic
1182627274 22:31656743-31656765 GAGTGAGTGAGGAGGAAGAGAGG - Intronic
1182827363 22:33277314-33277336 CAGCCGATGTGGAGGAAGAAGGG + Intronic
1183175282 22:36219474-36219496 CAGAGGGTGAGGCAGGAGAATGG + Intergenic
1183197445 22:36363192-36363214 CTGTTGGGGAGGAGGGAGAAGGG - Intronic
1183383568 22:37502672-37502694 CAGAGGATGAGGACGAAGAGAGG + Exonic
1183385412 22:37511391-37511413 AAGGGGGTGAGGAGGAGGAGGGG + Intronic
1183774565 22:39955441-39955463 CAGATGGTGAGAAGGAAGAATGG - Intronic
1183866488 22:40708338-40708360 AAGAGGAAGAGGAGGAAGAAGGG + Intergenic
1184096187 22:42317726-42317748 CAGTGGGGAGGGTGGAAGAAGGG + Intronic
1184183059 22:42844086-42844108 CAGTGGGAGGGGAAGAAGAGGGG + Intronic
1184379497 22:44136228-44136250 CAGAGGGTGGGGAGGAGGATAGG + Intronic
1184681236 22:46073289-46073311 GAGTTTGTGAGGAGCAAGAAAGG + Intronic
1184730096 22:46367093-46367115 CAGTGGAAAAGGAGGACGAAGGG + Exonic
949339917 3:3018481-3018503 CAGTGAGTGAGGATGCAGAATGG + Intronic
949442157 3:4093462-4093484 CAGTGGTTGGGGAGAAGGAAAGG + Intronic
949559786 3:5190286-5190308 CAGTCTGTGAGCAGGAATAAAGG - Intronic
949729488 3:7092111-7092133 CGGAGGTTGAGGAGGGAGAATGG - Intronic
949855523 3:8457720-8457742 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
950198307 3:11025383-11025405 AAATGGGGGAGGAGGAAGCAAGG + Intronic
950543497 3:13625837-13625859 AAGAGGGTGAGCAGGAGGAATGG - Intronic
950582054 3:13868870-13868892 CAGAGGGAGAGAAGGAAGGAGGG + Intronic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
950713384 3:14829803-14829825 CAGGTGGGGAGGAGGAAGGAGGG - Intronic
951470121 3:23046701-23046723 CAGGAGGTGAAGGGGAAGAAAGG - Intergenic
951510728 3:23499130-23499152 CTTTGGGTGGGGAGAAAGAAAGG + Intronic
951595741 3:24316487-24316509 TGGTGGGGGAGGAGGAACAAGGG - Intronic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
952226987 3:31387370-31387392 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
952938028 3:38415891-38415913 CAGGAGGTGAAGGGGAAGAAAGG + Intronic
952981420 3:38739080-38739102 GGGTGGGTGAGGAAAAAGAATGG - Intronic
952988666 3:38811814-38811836 CAGTATGAGAGGAGGAAAAAGGG - Intergenic
953025269 3:39141525-39141547 GTGTGGGTGTGTAGGAAGAAGGG + Intergenic
953474044 3:43191097-43191119 CACTGGGTGAGGAGCTACAATGG + Intergenic
953528517 3:43715963-43715985 CAGAGGGTGAGGAGTAAGTGAGG + Intronic
953723063 3:45373193-45373215 AAGGGGGTGAGGAGGTAGCATGG + Intergenic
954635411 3:52068382-52068404 TTGTGGAGGAGGAGGAAGAAAGG + Intergenic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956409540 3:68965364-68965386 CAGCTGGTGAGGTGGAAGAATGG + Intergenic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
958054597 3:88393040-88393062 CAGGAGGAAAGGAGGAAGAATGG + Intergenic
958710368 3:97709863-97709885 CGGTAGGTGAGGGGGAAGCAAGG - Intronic
958736211 3:98012032-98012054 GAGTTGGTGAGGAGGAAAACAGG + Intronic
958993406 3:100873733-100873755 CAGTAGGGGAGGAGAAAGTAAGG + Intronic
959215467 3:103445857-103445879 CAGAGGCTGAGGAAGGAGAACGG + Intergenic
959305750 3:104663891-104663913 CAGGGGCTGAGGAGGTTGAAGGG + Intergenic
959749946 3:109822372-109822394 GAGAGGCTGAGGAAGAAGAATGG - Intergenic
960324857 3:116283350-116283372 CAGTTGTTGAGTGGGAAGAATGG + Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960904813 3:122589988-122590010 GAGAGGGTGAGGCAGAAGAATGG - Intronic
961563842 3:127749527-127749549 CAGTGAGTAAGGATGAATAAAGG - Intronic
961593385 3:127997545-127997567 CAGGGGCTGGGGAGGAGGAATGG + Intergenic
961853037 3:129840734-129840756 CAGAAGGTGAAGGGGAAGAAAGG - Intronic
962311213 3:134328284-134328306 GAGAGAGAGAGGAGGAAGAAAGG - Intergenic
962380940 3:134897703-134897725 GGGTGTGTGAGGAGGAATAAAGG - Intronic
962685679 3:137845462-137845484 TAGTGAGTGAGAAGAAAGAATGG + Intergenic
962700680 3:137996926-137996948 CAGTGGGAGGGCAGGAGGAAGGG - Intergenic
962743183 3:138378136-138378158 CCCTGGGTGAGGAGTAAGAAGGG - Intronic
962924582 3:139979859-139979881 CACTAGGCGAGGGGGAAGAAGGG - Intronic
962978005 3:140463147-140463169 CAGGGGCTGAGGAGGAATCATGG - Intronic
962989507 3:140565502-140565524 CAGGGGGTGAGCAGCAAGCATGG + Intronic
963003974 3:140708776-140708798 GAGAGGATGAGGAGGAAGGAAGG + Intergenic
963158047 3:142120255-142120277 CAGAGGCTGAGGCAGAAGAATGG + Intronic
963723492 3:148892110-148892132 CAGTGGGAGAGTAGAAAAAAAGG - Intronic
964297306 3:155247772-155247794 AAGAGGGAGAGGAGGTAGAAGGG + Intergenic
964468565 3:157026237-157026259 CAGAGTGAGAGGAAGAAGAAAGG - Intronic
964564323 3:158033129-158033151 GGGTGGGGGAGGAGGATGAAGGG + Intergenic
964692205 3:159462369-159462391 CAGTCAGTGAGGAGGACGCAGGG - Intronic
964917024 3:161851595-161851617 GAGTGAGTGAGGAAGGAGAATGG + Intergenic
965143289 3:164866085-164866107 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
965404731 3:168254949-168254971 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
965628694 3:170708228-170708250 AGGTAAGTGAGGAGGAAGAAGGG + Intronic
965834498 3:172836923-172836945 CAGAGGCTGAGGTGGGAGAATGG - Intergenic
965838558 3:172878158-172878180 CAGTGTGTGACGAGGAAACAGGG - Intergenic
966001754 3:174957287-174957309 CAATGAGTCAGAAGGAAGAAAGG + Intronic
966179831 3:177178114-177178136 CAGTGGGTGTGGAGCTGGAATGG + Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
967991347 3:195133344-195133366 GAGTGGGAGAGGGGGAAGAAGGG + Intronic
968091610 3:195901517-195901539 CAGCTGCTGAGGAGGAAGAGAGG + Intronic
968124155 3:196146138-196146160 CACTGGGTTAAGAGGAGGAAAGG - Intergenic
968475325 4:803493-803515 CAGAGGCTGAGGCGGGAGAATGG - Intronic
968889190 4:3358951-3358973 GAGGGGAGGAGGAGGAAGAAGGG - Intronic
968889210 4:3359002-3359024 GAGGGGAGGAGGAGGAAGAAGGG - Intronic
968937704 4:3621095-3621117 CTTTGAGTGAGGAGGAAGCAAGG + Intergenic
969032206 4:4224401-4224423 GAGGGAGGGAGGAGGAAGAAAGG + Intronic
969294897 4:6263988-6264010 AAGTGGGAGAGGACGAAGGAGGG + Intergenic
969316291 4:6383202-6383224 CTGAGGGGGAGGAGGAAGAGTGG + Intronic
969334972 4:6502465-6502487 CAGAGGGAGGGCAGGAAGAAGGG - Intronic
969668413 4:8575498-8575520 CAGATGGTAAGGAGGAGGAAGGG - Intronic
969713250 4:8856485-8856507 CAGGGGAAGGGGAGGAAGAAGGG + Intronic
970020990 4:11568320-11568342 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970204906 4:13645951-13645973 CAGTAGGTGTGGAGGGAGAGAGG + Intergenic
970303022 4:14701807-14701829 CAAATGTTGAGGAGGAAGAAAGG + Intergenic
970701503 4:18745968-18745990 CAGGGGCTGAGAGGGAAGAAGGG - Intergenic
972714762 4:41634493-41634515 CAGTGGGAGAGAAGGCAGAGTGG + Intronic
972813353 4:42614813-42614835 GAGTGGGAAAGGAGGAAGAGGGG - Intronic
973652950 4:53015066-53015088 CAGTGAGTCAGGAGGAGAAAAGG + Intronic
973686749 4:53377891-53377913 GAGGGGATGAGGAGGAAGAGTGG + Exonic
973698256 4:53512462-53512484 CACTGGGTAGGGAGGAAGACTGG - Intronic
973808064 4:54544640-54544662 CAGTGTGGGAAGAGAAAGAAGGG - Intergenic
974033898 4:56800447-56800469 GTGGGGGAGAGGAGGAAGAAAGG - Intergenic
974044047 4:56882348-56882370 CAGAGGCTGAGGCAGAAGAATGG + Intergenic
974175316 4:58315306-58315328 CAGTGTGTGAGTAGGAACTAGGG - Intergenic
974683554 4:65195259-65195281 CTGAGGGTGCTGAGGAAGAAGGG + Intergenic
974912599 4:68141297-68141319 CAGTGATTTAGGAGGAAGAGTGG - Intergenic
975550080 4:75603623-75603645 GAGAGGTTGAGGCGGAAGAATGG + Intronic
975748713 4:77500629-77500651 TAGTGGGTGATTAGGAAGAAGGG + Intergenic
976680405 4:87749641-87749663 CAGTAAGTCAGGGGGAAGAAAGG - Intergenic
977184307 4:93917417-93917439 CAGAGGTTGAGGAGAAGGAAGGG + Intergenic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977350546 4:95880018-95880040 CAGTGGGAGAGGAATAAGAATGG - Intergenic
978292817 4:107165591-107165613 CAGTGGCTGAGAAGGAAGGAGGG + Intronic
978425303 4:108576149-108576171 CAGAGGCTGAGGCAGAAGAATGG + Intergenic
978740556 4:112132922-112132944 GAGAGAATGAGGAGGAAGAAGGG + Intergenic
979733400 4:124052501-124052523 AAGGGGCTGAGGGGGAAGAAAGG + Intergenic
980067831 4:128209616-128209638 CAATCTGTGAGGCGGAAGAATGG + Intronic
980400885 4:132284514-132284536 TAGTGAGAGAGGAGGAAGGAAGG + Intergenic
980794471 4:137663164-137663186 CAGTGGGTGGGGAGAGAGAGTGG - Intergenic
981112353 4:140950073-140950095 CAGAGGGTGATGAGGAAAACTGG + Intronic
981408475 4:144399355-144399377 AAGAGGCTGAGGCGGAAGAATGG + Intergenic
981467383 4:145088884-145088906 CAGTGAGTAAGGAGGAGAAATGG - Intronic
981871229 4:149487982-149488004 CAGGGGGTTAGGGGGATGAATGG + Intergenic
982072357 4:151706460-151706482 AAGTTGGTGAGGAGGAAGCCTGG - Intronic
982130339 4:152223763-152223785 CACTGGGTGAGGCAGAAGAGTGG - Intergenic
982295331 4:153822123-153822145 CAGTGGGTGTAGAGGAAGACAGG + Intergenic
982619731 4:157689341-157689363 CAGGGGATGAGAAGGAGGAATGG - Intergenic
982941924 4:161569936-161569958 CAGGGAGGGAGGAGAAAGAATGG + Intronic
983472484 4:168174078-168174100 CAGTGGGTGAGCAAGGTGAAGGG - Intronic
983595114 4:169457654-169457676 CAGGGGGAGAGAAGGAAGGAAGG + Intronic
983640303 4:169938980-169939002 CAGTGGCTGAGGCAGGAGAATGG + Intergenic
983884281 4:172963079-172963101 CAGGGGGTGAGGAGTCAGAGAGG - Intronic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984687652 4:182689628-182689650 TAGTGGGAGAGAAGGAAGATAGG - Intronic
984719677 4:182958041-182958063 GAGTAGATGAGGAGAAAGAAGGG + Intergenic
984780890 4:183524974-183524996 CGGTGGATGGGGAGAAAGAAAGG - Intergenic
984943487 4:184953648-184953670 CAGCGTGAGAAGAGGAAGAATGG + Intergenic
985026488 4:185744068-185744090 AAGTGGAAGAGGAGGAGGAAAGG - Intronic
985115641 4:186587720-186587742 CAGTGGCTGAGATAGAAGAATGG - Intergenic
985917044 5:2930147-2930169 CAGTGGGAGAGGAGAAAGCAAGG - Intergenic
986060764 5:4187999-4188021 CTTTGGGAGAGGAGGAGGAAGGG + Intergenic
986325548 5:6670596-6670618 CAGTGGGTGCTGAGGACGGATGG + Intergenic
986480412 5:8181027-8181049 CACCTGGTGAGGAGGAGGAAGGG - Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986613880 5:9597115-9597137 CAGTGACAGAGGAGGAGGAAGGG - Intergenic
986769441 5:10958391-10958413 CAGGGGATGTGGAGGAAGGAGGG - Intergenic
986808036 5:11327191-11327213 CAGTGGGAAAGGACAAAGAAGGG + Intronic
986971865 5:13346220-13346242 GAGTGGGTGGGCAGGAAGCAGGG + Intergenic
987162420 5:15157829-15157851 AAGTGGGGAAGGAGGAAGATTGG + Intergenic
987468353 5:18299320-18299342 TAGTGGAGCAGGAGGAAGAAAGG + Intergenic
988136372 5:27176276-27176298 CAGAAGGTGAAGGGGAAGAAGGG + Intergenic
988140522 5:27233212-27233234 GAGTGAGTGTGGAGGAGGAAAGG - Intergenic
989056588 5:37371355-37371377 GATAGGGTGAGGAGGAAGGAGGG + Intergenic
989187879 5:38642666-38642688 CACTGGGAGAGGAGGACGGAGGG - Intergenic
989216837 5:38913443-38913465 AAGAGGCTGAGGTGGAAGAAAGG + Intronic
990021643 5:51135065-51135087 CAGCTAGAGAGGAGGAAGAAAGG - Intergenic
990524557 5:56612042-56612064 AAGTGGGTGAGGAGGAGGTGGGG + Intergenic
990631384 5:57674292-57674314 CAGAGGGAGAGAAGGAAGGAGGG - Intergenic
990688516 5:58335512-58335534 CAGTGGGTAAGAAAGAAGCAAGG - Intergenic
990879316 5:60521693-60521715 GAAGGGGAGAGGAGGAAGAAAGG + Intronic
990892271 5:60662281-60662303 CAGAGGCTGAGGCGGGAGAATGG + Intronic
991267615 5:64740502-64740524 CAGTGGGTTATGAAGTAGAAAGG + Intronic
991533415 5:67639585-67639607 ATGTGTGGGAGGAGGAAGAAAGG - Intergenic
992050885 5:72939600-72939622 CAGAGGCTGAGGGGGAAGAATGG + Intergenic
992079647 5:73222977-73222999 CAGTGGCTGAGGAACCAGAAAGG + Intergenic
992409616 5:76492542-76492564 CAGTGGGAGGGAAGGAAGAAAGG + Intronic
992792795 5:80228305-80228327 GAGGGGGAGAGGAGGAAGGAAGG + Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993335825 5:86657277-86657299 AGGTGGGTGAGGAAGAAGATGGG + Intergenic
993769698 5:91910919-91910941 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
993858527 5:93105012-93105034 CAAGGGGAGAGGAAGAAGAAAGG - Intergenic
994024671 5:95069127-95069149 TAGTGGGTGAGGAGAAAAATAGG - Intronic
994125459 5:96165069-96165091 AAGTGGCTGAGGAGGAAGTGAGG + Intergenic
994302198 5:98159389-98159411 CAGTGGGTGGGGAGAAGGGAAGG + Intergenic
994307616 5:98225959-98225981 CAGTGCGTGAGAATTAAGAAAGG + Intergenic
994881967 5:105509581-105509603 CAGTGGGGTAGGAGGAAGTTAGG + Intergenic
994960495 5:106595541-106595563 CAGTGGTGGAAGAGGAGGAAGGG - Intergenic
995255046 5:110036376-110036398 AAGAGGGGGAAGAGGAAGAAAGG - Intergenic
995391939 5:111649494-111649516 AAGTGGATGGGGAGGAAAAATGG + Intergenic
995463256 5:112424495-112424517 AAGTGAGTCAGGAGGCAGAATGG - Intergenic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
995762308 5:115576408-115576430 AAGTCAGTTAGGAGGAAGAATGG - Intergenic
995895636 5:117007373-117007395 CAGAAGGTGAAGAGGAAGTAAGG + Intergenic
996008379 5:118451232-118451254 ATGGGGGTGGGGAGGAAGAATGG + Intergenic
996286187 5:121795767-121795789 CAGTGGGGGAGGCAGTAGAAAGG + Intergenic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
996805113 5:127445996-127446018 AGGGGGGTGAGGAGGAAGAGAGG + Intronic
997383054 5:133451023-133451045 AACTGGGAGAGGAAGAAGAATGG + Intronic
998113373 5:139518718-139518740 CAGAGGCTGAGGAGGAAGAATGG - Intergenic
998206346 5:140159426-140159448 CAGTCTGTTAGGAGGAAGGAGGG - Intergenic
998228539 5:140344958-140344980 CACTGGGAGAGGATGAAGTATGG + Intronic
998431301 5:142072626-142072648 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
998622138 5:143806666-143806688 AGTTGGGTGAGTAGGAAGAAAGG - Intergenic
999204259 5:149836872-149836894 CAGAGGAGGAAGAGGAAGAAGGG + Exonic
999305174 5:150514930-150514952 CACTGGGGGAGGAGGAAGAAAGG + Intronic
999529458 5:152446405-152446427 CAGGGGGTGAGGTGTAAGGAGGG - Intergenic
999869962 5:155739400-155739422 CAGTGGGTGAGTAGGTGGTAGGG + Intergenic
999968517 5:156835441-156835463 CAGAGGGAGAGGGGTAAGAATGG - Intergenic
1000279439 5:159769488-159769510 CAAAGGGTGAGGATGTAGAAAGG - Intergenic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1000900118 5:166902519-166902541 GGGTAGGTGAGGAGGAGGAAAGG + Intergenic
1001050427 5:168409588-168409610 CAGTTGGTGAGGAGGAAACAGGG - Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001228771 5:169967955-169967977 CACATGGGGAGGAGGAAGAAAGG + Intronic
1001666955 5:173441110-173441132 GAGTGTTTCAGGAGGAAGAATGG - Intergenic
1001707716 5:173753780-173753802 CAAGGGGCGAGGAGGAAGAGGGG - Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1001862223 5:175067380-175067402 CCTTTGGTGAGGAGGAAGAAAGG + Intergenic
1001885189 5:175283888-175283910 CAAAGGGACAGGAGGAAGAATGG + Intergenic
1001983193 5:176050840-176050862 CTGGGGGGGAGGAGGAAGTAAGG - Intronic
1002065606 5:176650246-176650268 ACGAGCGTGAGGAGGAAGAACGG + Intronic
1002234272 5:177793212-177793234 CTGGGGGGGAGGAGGAAGTAAGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1002772747 6:303545-303567 CAGTGGGAGTGAAGGAAGATAGG + Intronic
1003146383 6:3513637-3513659 CAGAGGATGGGGAGGCAGAATGG + Intergenic
1003262161 6:4527844-4527866 CAGAGGCTGAGGTGGAAGAATGG + Intergenic
1003408635 6:5843946-5843968 TGGTGGCTGAGGAGGAAGACAGG + Intergenic
1003562709 6:7196048-7196070 CAGGGGGTGAGCAGGAGGAGGGG - Intronic
1003592208 6:7445826-7445848 CAGAGGGTGAAGAGTCAGAAGGG + Intergenic
1003681155 6:8258401-8258423 AGGAGGGAGAGGAGGAAGAAGGG + Intergenic
1003681247 6:8259138-8259160 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
1003762064 6:9190122-9190144 CATTGGTTGAGGGTGAAGAATGG + Intergenic
1004723512 6:18289682-18289704 CAATGGGTGTTGAGGTAGAATGG - Intergenic
1005386519 6:25290608-25290630 CAAAGGGTGTGGAAGAAGAAGGG - Intronic
1005809620 6:29506056-29506078 CTGAGGGTGGGGATGAAGAAGGG - Intergenic
1005889278 6:30123551-30123573 CAGAGGGTGGGGAGGAGGGATGG + Intergenic
1005925758 6:30444221-30444243 CAGTGGAGCAGGAGGAGGAAGGG - Intergenic
1006496141 6:34425047-34425069 AGGAGGGTGAGGAGGAAGATGGG - Intronic
1006589367 6:35142710-35142732 GAGAGGGCGAGGAGGAGGAAGGG - Intronic
1006670239 6:35725878-35725900 AAGTGGGGGAGGAGGAGGCAGGG - Intronic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1006706512 6:36025572-36025594 CAAAGGGTGAGGAGGAAGCTTGG - Intergenic
1006794010 6:36720974-36720996 GATTGGATGAGGAGGAGGAATGG + Intronic
1007187099 6:39981199-39981221 CAGTGGGTGGCGGGGAAGAGGGG + Intergenic
1007247179 6:40471069-40471091 CAGTGGCTGAGAAAGAAAAAGGG + Intronic
1007288530 6:40766010-40766032 TAGAAGGTGAGAAGGAAGAATGG - Intergenic
1007471029 6:42090531-42090553 TAGAGGGTGTGGAGGAGGAAGGG + Intergenic
1007589235 6:43011548-43011570 CTGTGGGTGAGGAGCAGGTAGGG - Exonic
1008232579 6:49001765-49001787 TAATGGGTGAGGAGGAAGAAGGG - Intergenic
1008512051 6:52284944-52284966 CAGTGAGTGAGGCGGAGGGAGGG - Intergenic
1008616772 6:53234029-53234051 CAGTGGCTGAGGCTGGAGAATGG + Intergenic
1008836691 6:55840973-55840995 CAGTGGGTGAGGAAGCATTATGG + Intronic
1009022123 6:57957008-57957030 CAGAGGCTGAGGCGGGAGAATGG + Intergenic
1009710641 6:67314069-67314091 CGGTGGCTGAGGCGGGAGAATGG - Intergenic
1009858774 6:69297558-69297580 CGGTGGGGGAGGAGGAATATTGG + Intronic
1010280442 6:74017521-74017543 CAGTGGTTGAGCAGGATGAATGG + Intergenic
1010732117 6:79402298-79402320 CATTGGGAGAAGAGGAAGAAAGG + Intergenic
1010879882 6:81154080-81154102 CAGAGGTTTAGGAGGAAAAATGG - Intergenic
1011087640 6:83560203-83560225 AGGAGGCTGAGGAGGAAGAATGG + Exonic
1011187755 6:84697762-84697784 AAGTGAGGGAGGAGGAAGGAGGG + Intronic
1011893463 6:92195046-92195068 CAGTGGGTCAGGATGAAGCCAGG - Intergenic
1012161024 6:95886217-95886239 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1012378489 6:98590886-98590908 CTGGGTGTGAGGAGGAAGAAAGG + Intergenic
1012437092 6:99226320-99226342 GAGTCAGGGAGGAGGAAGAAGGG + Intergenic
1012450564 6:99349528-99349550 CAGAGGAGGAGGAGGAGGAAGGG + Exonic
1012614587 6:101261077-101261099 CAGTGGATGAGGAGAAGGATCGG + Intergenic
1012628058 6:101428849-101428871 CAGTGGAAGAGCAGGAAGACAGG - Intronic
1012837696 6:104291295-104291317 AAGTGGGTGTGGAGGCAGACAGG - Intergenic
1013504421 6:110785625-110785647 CAGAGGCGGAGGAGGTAGAAGGG + Intronic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1014494388 6:122102339-122102361 AAGTGGGGGAGGAGGAAGGAAGG + Intergenic
1014999789 6:128200863-128200885 GGGAGGGTGAGGAGGAAGAAGGG + Intronic
1015412512 6:132910893-132910915 CACTGGGTGAGGAGACAGGAAGG + Intergenic
1015452024 6:133380934-133380956 GAGAGGGAGAAGAGGAAGAAAGG - Intronic
1015850304 6:137565257-137565279 CAGAGGCTGAGGAAGGAGAATGG - Intergenic
1016186330 6:141202068-141202090 TATTGGGTGAAGAAGAAGAAAGG + Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016881605 6:148917188-148917210 AAATGGCTGAGGGGGAAGAAAGG - Intronic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017142368 6:151202962-151202984 CAAAGGATGAGGAGGAGGAAAGG + Intergenic
1017737870 6:157380746-157380768 CAGCTGGGGAGGAGGAAGAAGGG + Intergenic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1017967197 6:159276806-159276828 AAAGGGGTGGGGAGGAAGAATGG - Intergenic
1018576313 6:165263621-165263643 CTGAGGGTGTGGTGGAAGAAGGG + Intergenic
1018646598 6:165954609-165954631 CAGGTGGTGAGGAGGGAGGACGG - Intronic
1018736165 6:166688548-166688570 CACTGGGTTTGGAGGATGAAAGG + Intronic
1018739550 6:166717024-166717046 CAGGGAGTGAGGATGGAGAATGG + Intronic
1018828438 6:167424144-167424166 CAGCGGGTGAGGAGGAGCCACGG - Intergenic
1018830995 6:167443503-167443525 GAGTGGGTGGGGAAGATGAAGGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019196797 6:170287901-170287923 GAGAGGGAGAGGAGGAAGGAAGG - Intronic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1019919990 7:4157355-4157377 AAGTGGGAAGGGAGGAAGAAGGG + Intronic
1019936722 7:4262795-4262817 TAGGGGGTGATGAGGTAGAAGGG - Intronic
1019936781 7:4262935-4262957 TGGTGGGTGATGAGGTAGAAGGG - Intronic
1019969141 7:4526131-4526153 CAGGGGAAGAGGAAGAAGAAAGG + Intergenic
1020318353 7:6923074-6923096 CAGAGGCTGAGGAAGGAGAATGG + Intergenic
1020530166 7:9323144-9323166 CAGAAGGTGAGGAGCAAGAATGG + Intergenic
1020680982 7:11235842-11235864 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021351260 7:19596627-19596649 TAGAGAGTGGGGAGGAAGAAAGG - Intergenic
1021804089 7:24338016-24338038 CAGTGGGGAAGGATGAAGAGAGG + Intergenic
1021838790 7:24705932-24705954 CCCTGGGGGAGGAGGGAGAAGGG + Intronic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1022632541 7:32098874-32098896 CAGGGGCTGAGGAGGAGGACAGG + Intronic
1022639209 7:32165514-32165536 CAGAAGGTGAAGAGGAAGTAAGG + Intronic
1022891377 7:34703264-34703286 CAGAGGCTGAGGCGGGAGAATGG + Intronic
1023340504 7:39214321-39214343 CAGGGGAGGAGGAGGAAGGAAGG - Intronic
1023369453 7:39498544-39498566 CAGAGAGTGAAGAGAAAGAATGG - Intergenic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1023981094 7:45070454-45070476 CAGTGGCAGATGGGGAAGAATGG + Intronic
1024080763 7:45853364-45853386 CAGTGGATGAGGAGGTGTAAGGG + Intergenic
1024217157 7:47257118-47257140 TACAGGGTGTGGAGGAAGAAGGG + Intergenic
1024224934 7:47319314-47319336 CAGTGGGAGTGGAGGTAGACAGG - Intronic
1024792116 7:52978345-52978367 CAGGGAGGGAAGAGGAAGAATGG - Intergenic
1024903718 7:54352230-54352252 CACTGGGTGGGGAGGACGACAGG + Intergenic
1025604717 7:63031211-63031233 CAGAGGGTGAGGCAGGAGAATGG - Intergenic
1025605771 7:63038942-63038964 CAGTGGAGTAGGAGGAGGAAAGG + Intergenic
1026228485 7:68463043-68463065 GAAAGGGTGAGGAGGAGGAAAGG - Intergenic
1026506987 7:70993334-70993356 CAGAGGCTTTGGAGGAAGAATGG - Intergenic
1027269603 7:76512464-76512486 GAGTGGGTGAGAGGGCAGAAGGG - Intronic
1027320313 7:77006358-77006380 GAGTGGGTGAGAGGGCAGAAGGG - Intergenic
1027475265 7:78622379-78622401 CAGTAGGCGAGGAGGAGGAAAGG + Intronic
1027853725 7:83482458-83482480 CAGGGGCTGAGGCAGAAGAATGG + Intronic
1027996733 7:85434428-85434450 CAGAGGTTTAGGAGGAATAATGG + Intergenic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028380858 7:90196940-90196962 CTGGGAGTGAGGAAGAAGAAGGG - Intronic
1028396616 7:90376128-90376150 CAGAGGCTGAGGCGGGAGAATGG + Intronic
1028571247 7:92289919-92289941 GAGAGGCTGAGGTGGAAGAATGG - Intronic
1029045851 7:97627486-97627508 CAGTGGCAGAGCAGGGAGAAAGG + Intergenic
1029052907 7:97708319-97708341 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1029144784 7:98438189-98438211 GAGTGGCTGAAGAGGAAGACCGG + Intergenic
1029746988 7:102521460-102521482 CAGGGGATGAGGAGGAAGTTGGG + Intergenic
1029764941 7:102620549-102620571 CAGGGGATGAGGAGGAAGTTGGG + Intronic
1030495326 7:110291543-110291565 CCCTGGGTGAGGCAGAAGAATGG + Intergenic
1030979500 7:116169965-116169987 CAGTGGGTGATAAGGAAGTAGGG - Intergenic
1031071737 7:117169546-117169568 CACTGGATGAGGATGAAGAGAGG - Intronic
1031083379 7:117279325-117279347 CTGTGGGGGAGGAAGTAGAAAGG - Intronic
1031133286 7:117858263-117858285 GAGTGGCTGAGGCAGAAGAATGG + Intronic
1031272127 7:119665335-119665357 CAGTGGGTTATGAGGATGTAAGG + Intergenic
1031633846 7:124077974-124077996 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1032037489 7:128531245-128531267 CAGTGGGAGAGGAGGGGGAGGGG - Intergenic
1032883876 7:136116875-136116897 CTGTGGCTGAAGAGGAAGGAGGG - Intergenic
1033017105 7:137682556-137682578 CTGTGGATTGGGAGGAAGAAGGG - Intronic
1033329201 7:140404114-140404136 CAGCGAGGCAGGAGGAAGAAGGG + Exonic
1033969678 7:147024772-147024794 CAGTGGATGAAGAGGAATCATGG + Intronic
1034122017 7:148636806-148636828 AAGAGGGTGAGGAGGGTGAAGGG - Intergenic
1034557959 7:151861932-151861954 CTGTGTGTGAGCAGGAAGATGGG - Intronic
1034691395 7:153017250-153017272 CAGAGGGAGAGGAGGAGGAAGGG + Intergenic
1035141343 7:156765590-156765612 AAGGAGGGGAGGAGGAAGAAAGG - Intronic
1035158026 7:156930031-156930053 CAGAGGATGAGGAGGAACCAGGG - Intergenic
1035622369 8:1043612-1043634 CAGTGGGGAAGGGGGATGAAGGG + Intergenic
1035644018 8:1204735-1204757 CAGTAGGAGAGGAGAAAGCAAGG + Intergenic
1035650246 8:1258431-1258453 CGGTGGGTGGGGGGGAAGAGGGG + Intergenic
1035712758 8:1731056-1731078 GAGAGGGTGAGGCAGAAGAATGG + Intergenic
1035722261 8:1801018-1801040 CAGTAGGTTAGGAGGATGAGAGG + Intergenic
1035869044 8:3117173-3117195 CAGAGGCTGAGGTGGGAGAATGG - Intronic
1036127970 8:6081221-6081243 CAGCAGGTGAGGAAGTAGAAGGG - Intergenic
1036527188 8:9546322-9546344 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1036683008 8:10889646-10889668 CAGTAGATGGGTAGGAAGAATGG - Intergenic
1037054531 8:14422921-14422943 CAGGGACTGAGGAGGGAGAATGG + Intronic
1037098928 8:15018939-15018961 CAGAAGGTGAAGAGGAAGAAGGG + Intronic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037342076 8:17856635-17856657 GAGAGGCTGAGGCGGAAGAATGG + Intergenic
1037810088 8:22081753-22081775 CAGAGGGTGAGGAGGAATGAGGG + Exonic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038240525 8:25803674-25803696 CAGTGGGTGAGCAGGTAGGGAGG + Intergenic
1038255543 8:25947771-25947793 GACTGGGTGAAGATGAAGAAGGG - Intronic
1038408572 8:27340979-27341001 CAGTGGGAGAGACGGATGAAGGG + Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1039273112 8:35904876-35904898 AACTGGGTGAGGAAGAAGACAGG + Intergenic
1039412500 8:37366620-37366642 CAGTTGGGGAGGAGGAGGAGTGG - Intergenic
1039465020 8:37778827-37778849 TGGTGGCTGAGGTGGAAGAATGG + Exonic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040011019 8:42661301-42661323 AGGTGGGGGAGGAGGGAGAATGG - Intergenic
1040470431 8:47731750-47731772 CTGGGGGTAGGGAGGAAGAAAGG + Intronic
1040640201 8:49324421-49324443 TAGAAGGTGAAGAGGAAGAAAGG - Intergenic
1040850259 8:51893904-51893926 CAGTGGGTGCTCAGGAAGTATGG - Intronic
1041102663 8:54412308-54412330 CTGCAGGTGAGGAGGAAGCATGG - Intergenic
1041315621 8:56559136-56559158 CAGGCTGTGAGGACGAAGAAAGG - Intergenic
1041385386 8:57297006-57297028 CAGTGAGAAAGAAGGAAGAATGG + Intergenic
1041525818 8:58804365-58804387 CTGAGGAGGAGGAGGAAGAAGGG - Intergenic
1042165106 8:65937768-65937790 AAGTGAGAGAGGAGGAAGGAAGG - Intergenic
1042400634 8:68341917-68341939 GAGTGTGTGAGGAGAAAGATTGG + Intronic
1042426624 8:68656695-68656717 CATTGTGAGAGGAGGAGGAAAGG - Intronic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1043304218 8:78773843-78773865 CACAGTGTGAGGAGGAACAAAGG + Intronic
1043336600 8:79183681-79183703 TAGAGGGAGAGGGGGAAGAATGG - Intergenic
1043450026 8:80357108-80357130 CAGAGGCTGAGGTGGAAGAATGG - Intergenic
1043499513 8:80838700-80838722 CACTGGAGGAGGAGGAAGAGGGG + Intronic
1044226579 8:89725902-89725924 CAGTGGGGGAAGGGGCAGAATGG - Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044545493 8:93454566-93454588 CAGTGGCTGAGGCAGGAGAATGG + Intergenic
1044554759 8:93550925-93550947 CAGAGGCTGAGGTGGGAGAAGGG + Intergenic
1044750933 8:95414786-95414808 CAGTGAATGAGGAGAAGGAAAGG - Intergenic
1044820862 8:96154819-96154841 CGGTGGCGGAGAAGGAAGAAGGG - Intronic
1045165356 8:99598735-99598757 AAGTGGAGGAGGAGGAGGAAGGG - Intronic
1045244431 8:100430638-100430660 GATTTGGTGGGGAGGAAGAAAGG - Intergenic
1045362483 8:101445768-101445790 CAATGGGTGAGGGGGAAGGAGGG + Intergenic
1045692625 8:104775119-104775141 CAGTGAGTGGGGAGGGAGACAGG + Intronic
1045710339 8:104975648-104975670 GAGTGGGGGAGGAGAGAGAAAGG - Intronic
1045820550 8:106332047-106332069 CTGAGGATGGGGAGGAAGAAGGG - Intronic
1045864577 8:106850722-106850744 CAGAGGCTGAGGCGGGAGAATGG - Intergenic
1047445243 8:124913590-124913612 CAGTGTGTGAGGATGAGGCATGG + Intergenic
1047764810 8:127981746-127981768 CAGTGGGGGTGTGGGAAGAAAGG - Intergenic
1047854898 8:128898885-128898907 CAGAGGGAGAGGAGGAACTATGG + Intergenic
1048253985 8:132891246-132891268 CTGTGAGTGAGGTGGAGGAAAGG + Intronic
1048297521 8:133225393-133225415 CTGTGGGTGAGGTGGAGGCATGG + Exonic
1048386963 8:133921105-133921127 GAATGGGAAAGGAGGAAGAATGG + Intergenic
1048407139 8:134135318-134135340 GAGTGGGCTTGGAGGAAGAAAGG - Intergenic
1048781680 8:138008429-138008451 CAGGGCCTGAGGAGGAAGAATGG - Intergenic
1048986017 8:139735443-139735465 CAGAGGTAGAGGAGGGAGAAGGG - Intronic
1049033555 8:140056303-140056325 AGGAGGCTGAGGAGGAAGAATGG + Intronic
1049187479 8:141265200-141265222 CTGTGGGTGAGGAGGACCAGAGG - Intronic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1049325677 8:142020312-142020334 CAGTGGCTGAGGAGGCTGAGGGG - Intergenic
1049621565 8:143600593-143600615 CTGTGGCTGATGAGGAAGCAGGG - Exonic
1049797673 8:144504029-144504051 CAGTGGGTGAGGTGGCAGGCGGG - Intronic
1049844510 8:144793355-144793377 CCGTGGGTGGGGAGGCAGCAAGG + Intergenic
1050052910 9:1622069-1622091 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1050351197 9:4741874-4741896 CAGAGGAGGAGGAGGAAGGAGGG - Intronic
1050685696 9:8166442-8166464 AAGTGGGAGGGGAGAAAGAAGGG + Intergenic
1050945282 9:11510016-11510038 CAGAGGGTGAAGGGGAAGCAAGG - Intergenic
1051376765 9:16410077-16410099 CAATGGGTCTGGAGTAAGAAAGG + Exonic
1051811436 9:21054125-21054147 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1051818312 9:21135116-21135138 CAGGTGGTGAGGAGGATGAGAGG + Intergenic
1052319326 9:27150690-27150712 CAGTGGGGGTGCAGGAAGCATGG - Intronic
1052598076 9:30587284-30587306 CAGATGTTGAGGAGGATGAATGG - Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1054783991 9:69192900-69192922 AAGTGAGAGAGAAGGAAGAAAGG - Intronic
1054877200 9:70109240-70109262 CAGTGGTTGAGGATGGAGCATGG + Intronic
1055231906 9:74076647-74076669 CAGAAGGTGAAGGGGAAGAAAGG + Intergenic
1055413273 9:76054016-76054038 CAGAAGGTGAGGAGGAGCAAAGG + Intronic
1055486510 9:76761225-76761247 CAATGGTGGAGGAGGAAGAAAGG - Intronic
1055899092 9:81213888-81213910 CAGGAGGTTAGGAGGAAGAAAGG - Intergenic
1055900569 9:81229541-81229563 GAGTTGGTGAGGAGGTGGAATGG - Intergenic
1055976610 9:81961651-81961673 CAGTGGGAGTGAAGGAAGCAGGG - Intergenic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1057183012 9:93039966-93039988 CAGTGAGTGTGCAGGAAGAAGGG + Intergenic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1057827197 9:98380359-98380381 GAGCGGGGGAGGAGTAAGAAGGG - Intronic
1057949114 9:99355890-99355912 CAGTGGGAGATGAGGCTGAAGGG + Intergenic
1058401047 9:104619730-104619752 CAGAGGCTGAGGTGGGAGAATGG - Intergenic
1058618424 9:106860458-106860480 CAGGCGGTGGGGAGGGAGAAAGG - Intergenic
1058710985 9:107679018-107679040 CAGAGGCTGAGAAGGGAGAATGG - Intergenic
1058879094 9:109271240-109271262 CTGTGGCTGAGCAGGAAGGATGG - Intronic
1058930552 9:109714819-109714841 TGGTGGATGAGGAGGAATAACGG + Intronic
1059095716 9:111411621-111411643 CAGTAGATGAGGAAGAAAAAAGG + Intronic
1059570208 9:115426147-115426169 CAGAAGGTGAAGAGGAAGCAAGG + Intergenic
1059670927 9:116491683-116491705 CACTGGGTGAGGAAGAACACTGG - Intronic
1059882672 9:118709064-118709086 CAGAGGCTGAGGAGAGAGAATGG - Intergenic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060395284 9:123312369-123312391 CCTTGGGTGAGAAGGAAGGAAGG + Intergenic
1060663230 9:125416501-125416523 CCCTGGGAGTGGAGGAAGAAGGG - Intergenic
1060709004 9:125837693-125837715 GGGTGGCTGAGGCGGAAGAATGG - Intronic
1061293492 9:129665494-129665516 AAGTGGGTGGGGAGGGTGAAGGG + Intergenic
1061489010 9:130934832-130934854 GTGTGGCTGAGGAGGTAGAATGG - Intronic
1061613493 9:131763840-131763862 CAGTGGCTGAGGGGGTGGAATGG - Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1062161794 9:135084627-135084649 CAAGGGGAGGGGAGGAAGAAAGG - Intronic
1185563150 X:1076100-1076122 TAGGGGCTGGGGAGGAAGAAAGG + Intergenic
1185603561 X:1354871-1354893 AAGGAGGTGAGGAGGAGGAAGGG + Intronic
1185952106 X:4448948-4448970 CATTGTGTGAGGAAAAAGAAGGG + Intergenic
1186125553 X:6409980-6410002 AGGTGGAAGAGGAGGAAGAAAGG + Intergenic
1186236101 X:7511884-7511906 CAGTGAGTGAGGAGAAGGAGAGG + Intergenic
1186276817 X:7948412-7948434 AAGTGGGAGTGGAGGAAGATTGG + Intergenic
1186422963 X:9440939-9440961 GAATGGGGGAGGGGGAAGAAAGG + Intergenic
1186966615 X:14793831-14793853 CAGTGAGTCAGGAGTCAGAAGGG + Intergenic
1187439773 X:19307498-19307520 GAGTGGAGGAGAAGGAAGAATGG + Intergenic
1188148028 X:26638491-26638513 CAGAAGGTGAGGAGGAAGCAAGG + Intergenic
1188257546 X:27981035-27981057 TAGTGGGAGAGGAGACAGAAAGG - Exonic
1188267132 X:28091100-28091122 AAGTGGGAGAGGAGGCAAAAAGG - Intergenic
1188515144 X:30977402-30977424 CTGAGAGTGAGGAGGCAGAAAGG - Intergenic
1188945019 X:36290019-36290041 GAGAGGGTGTGGAGGGAGAATGG - Intronic
1188959439 X:36471986-36472008 CAGCAGGTGAAGGGGAAGAAAGG - Intergenic
1189078861 X:37947467-37947489 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1189497347 X:41521050-41521072 CAGTGAGTGTGGAGGACCAAGGG - Intronic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1190250274 X:48718197-48718219 AGATGGGGGAGGAGGAAGAAAGG - Intergenic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1190380783 X:49837834-49837856 CAGGGAGTGAGGAGGTATAATGG - Intergenic
1190397646 X:50000976-50000998 CTGAGAGTGAGGAGGAAGGAAGG - Intronic
1191604296 X:63044441-63044463 AAGTGGGAGATGGGGAAGAATGG - Intergenic
1192203851 X:69083283-69083305 GAGGGGTTGGGGAGGAAGAAGGG + Intergenic
1192203918 X:69083606-69083628 CAGAGGGTCAGGAGAAGGAATGG + Intergenic
1192264322 X:69528851-69528873 CAGGGGGTAGAGAGGAAGAAGGG - Intronic
1192265048 X:69532035-69532057 CACTTGGTGAGGGGGAAGAGAGG - Exonic
1192717225 X:73657162-73657184 CAGAGGCTGAGGTGGGAGAATGG - Intronic
1193795163 X:85865363-85865385 CAGAGGGTGAAGGGGAAGCAAGG - Intronic
1193843346 X:86437425-86437447 CAGTGGGTGGGTAGGAGGAATGG - Intronic
1194135117 X:90131341-90131363 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1194212059 X:91082003-91082025 CAGTGGGTGAGGCGCAGGCAGGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195107801 X:101617380-101617402 GAGTGGGTGTGGAGAAAGAAGGG + Intronic
1195284360 X:103369135-103369157 TAGTGAGGGAGGAGGAAGAGAGG + Intergenic
1195342639 X:103919962-103919984 GAGGGGGTGAGGAGGTAGTAGGG + Intronic
1195379346 X:104256049-104256071 GGGAGGGGGAGGAGGAAGAAGGG - Intergenic
1195462185 X:105139951-105139973 CAGTGGGAGAGGAGGATGTGTGG + Intronic
1195658796 X:107358702-107358724 CAGAGGGAGAGAAGGAAGGAGGG + Intergenic
1196025257 X:111034999-111035021 CAGGGGCTGAGGTGGAAGGATGG + Intronic
1196059416 X:111391281-111391303 CAGAAGGTGAAGAGGAAGCAAGG - Intronic
1196118768 X:112025825-112025847 CAGTGGATGGGGAGTGAGAAAGG - Intronic
1197295664 X:124716441-124716463 CAGTGGATGAGGAAGGAGATTGG - Intronic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198370718 X:135986061-135986083 CTGGGGGTGCGGAGGAAAAAGGG - Intronic
1198752529 X:139949973-139949995 GAGTGGGAGAGAAGGAAGTAAGG + Intergenic
1198912582 X:141631090-141631112 TAGAGTGAGAGGAGGAAGAATGG + Intronic
1199086308 X:143634059-143634081 CGGTGGGTGAGGAGGAAGAGAGG + Intronic
1199686659 X:150271180-150271202 CAGAGGGGGAGGAGGTAGATTGG + Intergenic
1199991384 X:152989540-152989562 AAGAGGGGGAGGAGGAAGAGGGG - Exonic
1200250832 X:154552912-154552934 GAGGGGGTGAGGGGGAAGAATGG - Intronic
1200275892 X:154732114-154732136 CAGTGGGTGAGGAGTCAAAGAGG + Intronic
1200304249 X:155008447-155008469 GAGGGGGTGAGGGGGAAGAATGG + Intronic
1200480900 Y:3701433-3701455 CAGAAGGTGAAGAGGAAGCAAGG - Intergenic
1201476318 Y:14385797-14385819 CAGTGTGTGATGAGGAACAGGGG + Intergenic
1201738797 Y:17301513-17301535 CACTGTGTGAGGAAAAAGAAGGG + Intergenic