ID: 1118116225

View in Genome Browser
Species Human (GRCh38)
Location 14:62780327-62780349
Sequence GATCAGCCCTAGATTTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118116225 Original CRISPR GATCAGCCCTAGATTTATAA AGG (reversed) Intronic
909037955 1:70616051-70616073 GATAAATCCTAGATTGATAATGG - Intergenic
913408931 1:118528751-118528773 ACCCTGCCCTAGATTTATAAGGG - Intergenic
917363965 1:174208887-174208909 GAATAGCCCTATATTTTTAAAGG - Intronic
1065540155 10:26756380-26756402 TATCAGTCCTAAATTTACAAGGG + Intronic
1074688094 10:115978227-115978249 GAACAGCCTTAGAATTATAAAGG + Intergenic
1087897929 11:103608448-103608470 GTTCACCCTTAAATTTATAAAGG + Intergenic
1092313622 12:7386246-7386268 GATCTGCCCAAGATTAATCAAGG + Intronic
1107446773 13:40476500-40476522 GATCAGCACTTGATTTATCAGGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1118116225 14:62780327-62780349 GATCAGCCCTAGATTTATAAAGG - Intronic
1119373113 14:74164701-74164723 GATCAGCCCAAGAAGAATAAAGG + Intronic
1121623307 14:95365352-95365374 CATCAGCCCTCGATAAATAATGG + Intergenic
1122176259 14:99921775-99921797 GATGAGCTGTACATTTATAATGG - Intronic
1124867755 15:33509988-33510010 GGTCAGCCATAGATTTAAAAAGG - Intronic
1125734197 15:41912131-41912153 GATCAGCCCCAGGTTTATCAGGG - Intronic
1127248975 15:57209690-57209712 GATCTGACCTAGATTTTAAAAGG - Intronic
1127605687 15:60585530-60585552 GAAAAGCTCTAGATTTAAAAAGG + Intronic
1133763885 16:8821776-8821798 GCTCAGCCCTGGATATATATTGG + Intronic
1149333803 17:55613271-55613293 GGACACCCCTAGATCTATAAGGG - Intergenic
1157767088 18:50307561-50307583 GATCAGCCCTCCCTTTATAAGGG - Intergenic
1158830610 18:61273777-61273799 GACCAGACACAGATTTATAAAGG + Intergenic
928236856 2:29550012-29550034 GAAGAGCCATAGATTTGTAAAGG - Intronic
932461611 2:71885445-71885467 GCTCAGCCCTAGACATATGAGGG - Intergenic
933816302 2:86071671-86071693 GACCAGCCAGATATTTATAAGGG - Intronic
935702683 2:105825973-105825995 AATCTGCTCTAGAGTTATAAAGG - Intronic
938317235 2:130338586-130338608 GATCTGGCCTAGATATTTAAGGG - Exonic
948023881 2:234760589-234760611 AATGAGCCCTTGACTTATAAAGG - Intergenic
1172713176 20:36942978-36943000 GAACAACCATTGATTTATAAAGG - Intronic
949974561 3:9444117-9444139 TCTCACCCCTAGCTTTATAAGGG - Intronic
951679705 3:25282075-25282097 TATCAGCCCTAGTTTAGTAAAGG + Intronic
956675866 3:71731279-71731301 GATCAGCCATGGATTTGGAAAGG - Intronic
958626787 3:96636127-96636149 GAGCAGACCCAGATTTAAAAAGG + Intergenic
959105322 3:102058734-102058756 GATCTGGCCTACATTTATATGGG + Intergenic
959516540 3:107273359-107273381 TATCATACCTACATTTATAATGG - Intergenic
964245901 3:154653059-154653081 GATCAGCCCTACCTATATTATGG + Intergenic
969382796 4:6816772-6816794 GAACAGTCCTATATCTATAAAGG - Intronic
970291202 4:14574365-14574387 AAACAGCCATAGATTTAAAAAGG + Intergenic
970645386 4:18114698-18114720 GATAAGCCATTGATTTAAAAAGG - Intergenic
971644565 4:29181902-29181924 GATCCTCCCTAGATCAATAAAGG - Intergenic
979320339 4:119315920-119315942 GATCAGATTTAGATTTTTAAAGG + Intergenic
984284929 4:177716852-177716874 GGTCATCCCCAGATTTTTAATGG + Intergenic
984972461 4:185203609-185203631 GATCAGCCCTAAATTGAGATTGG - Intronic
990448846 5:55917313-55917335 GATAAGCCCGAGTTTTGTAAAGG + Exonic
992685641 5:79196957-79196979 GGTCAGGCCTAGTTTTGTAAGGG - Intronic
996517940 5:124394426-124394448 AATCAGCCCTATTTTTATATGGG - Intergenic
1006980842 6:38146442-38146464 GATGAGCCCTCGATTTCAAAGGG - Intronic
1007352940 6:41287314-41287336 GAACAGACTTAGATTTAAAAAGG + Intergenic
1008879136 6:56362919-56362941 GATAAGCCCTGGAAATATAAGGG - Intronic
1010851437 6:80782618-80782640 TTTCAGCACTAGATTTATTAAGG - Intergenic
1012670709 6:102043657-102043679 GATCAACCTTATATTTATAATGG - Intronic
1017328068 6:153162681-153162703 TATCAGCCCTAACTTTAAAAAGG - Intergenic
1018327166 6:162683999-162684021 GATAAGCCCTTCATTAATAATGG - Intronic
1029915870 7:104208939-104208961 GATCAGTCTTAGATTTGTGATGG + Intergenic
1039796164 8:40917422-40917444 CATCAGCCCTCGATTCATGATGG + Intergenic
1044778485 8:95719373-95719395 GTTCAGCCCTTGAAATATAAGGG - Intergenic
1045808426 8:106192671-106192693 GATCAGCTCTAGGTGTAAAATGG - Intergenic
1053608534 9:39685391-39685413 GATCAGCCCTATATTTTGACTGG - Intergenic
1053866382 9:42441756-42441778 GATCAGCCCTATATTTTGACTGG - Intergenic
1054244993 9:62657018-62657040 GATCAGCCCTATATTTTGACTGG + Intergenic
1054559120 9:66691549-66691571 GATCAGCCCTATATTTTGACTGG + Intergenic
1197374965 X:125671530-125671552 GATCAAATCTAGATTTATCAAGG - Intergenic