ID: 1118116669

View in Genome Browser
Species Human (GRCh38)
Location 14:62785432-62785454
Sequence CTGTAGTCAAGTAGATGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118116669_1118116673 15 Left 1118116669 14:62785432-62785454 CCGGTTCATCTACTTGACTACAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1118116673 14:62785470-62785492 TTTTTAGGTCAGCTCCCGCTGGG 0: 1
1: 0
2: 1
3: 1
4: 65
1118116669_1118116670 -8 Left 1118116669 14:62785432-62785454 CCGGTTCATCTACTTGACTACAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1118116670 14:62785447-62785469 GACTACAGAACATTTGATGCTGG 0: 1
1: 0
2: 1
3: 7
4: 77
1118116669_1118116671 0 Left 1118116669 14:62785432-62785454 CCGGTTCATCTACTTGACTACAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1118116671 14:62785455-62785477 AACATTTGATGCTGGTTTTTAGG 0: 1
1: 0
2: 4
3: 23
4: 287
1118116669_1118116672 14 Left 1118116669 14:62785432-62785454 CCGGTTCATCTACTTGACTACAG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1118116672 14:62785469-62785491 GTTTTTAGGTCAGCTCCCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118116669 Original CRISPR CTGTAGTCAAGTAGATGAAC CGG (reversed) Intronic
903117274 1:21188630-21188652 CTTTATTCAAGTAGAAGAAAAGG - Intergenic
905257591 1:36694815-36694837 CTGGAGGCAGGAAGATGAACAGG + Intergenic
905729771 1:40289074-40289096 CTATAATCAATTAGTTGAACAGG - Intronic
909207549 1:72778782-72778804 GTGTAGGCAAGTAGATGGGCAGG - Intergenic
910890947 1:92019509-92019531 CTGTAATCAACTGAATGAACAGG - Intergenic
912979912 1:114362054-114362076 CTCTAGTTAAGTAACTGAACTGG + Intergenic
913479903 1:119278054-119278076 CTGAAGGGAAGCAGATGAACTGG - Intergenic
915797284 1:158750445-158750467 CTGTAGTCAGGTAGCTAAGCAGG - Intergenic
920781210 1:208992790-208992812 CAGTAGCCAATTAGATGAAGTGG + Intergenic
921650538 1:217673135-217673157 CTGTAATGATGTAGATAAACTGG + Intronic
923802071 1:237219885-237219907 CAGTTGTCAAGTAAATGAAAAGG - Intronic
1065339575 10:24692132-24692154 CTGAAGTCTAGTAGATGGAGAGG + Intronic
1070380556 10:75877139-75877161 CTGTGGTGAAGAATATGAACTGG - Intronic
1070425998 10:76287983-76288005 CAGTACTCAAATAAATGAACTGG - Intronic
1072321831 10:94257934-94257956 TTGTAGTCAAATTAATGAACAGG - Intronic
1073730457 10:106281415-106281437 CTGTAGCCAAGAAGATAAAGCGG - Intergenic
1075941617 10:126394978-126395000 CTATATTCAAGTACATGAAGTGG - Intergenic
1078600434 11:12725654-12725676 CTGTAGTTCAGTAGAATAACAGG + Intronic
1079539953 11:21561272-21561294 ATGAAGGCAAGTGGATGAACTGG - Intronic
1079561983 11:21833007-21833029 ATGTAGTCATCTAGATGAATGGG + Intergenic
1087951932 11:104231687-104231709 CTGTAGTCAAGGACATGCATTGG - Intergenic
1092969455 12:13678125-13678147 CTGCATTCCAGCAGATGAACTGG - Intronic
1094200295 12:27788071-27788093 CAGAAGGCAAGTAGATGAAGGGG + Intronic
1105426539 13:20299497-20299519 CCGTAGTCAGGTAGGGGAACGGG + Intergenic
1106617390 13:31341933-31341955 CAGTAGTCAATTCGATCAACTGG + Intergenic
1106671379 13:31909186-31909208 CTGTTGCTAAGCAGATGAACTGG + Intergenic
1106848595 13:33764116-33764138 CTGTAGTCAATGAGATGACAAGG + Intergenic
1108144757 13:47464431-47464453 CAGAAGTGAACTAGATGAACAGG + Intergenic
1108450365 13:50556535-50556557 ATGTAGTCAAGTTTATGACCGGG + Intronic
1111609250 13:90582164-90582186 CTGAAGTCAAGTAGAAAAATAGG - Intergenic
1114249765 14:20948670-20948692 CTGTAGTCTAATAGGTGATCGGG + Intergenic
1118116669 14:62785432-62785454 CTGTAGTCAAGTAGATGAACCGG - Intronic
1120181283 14:81344962-81344984 CTGTAGGTAAGCAGATGAAAAGG + Intronic
1125888153 15:43244666-43244688 AGGTAGTCAATTAGATGAAGAGG + Intronic
1127038386 15:54945433-54945455 CAGTAGCCAATTAGATCAACTGG + Intergenic
1130800132 15:87254523-87254545 CAGTAGCCAATTCGATGAACTGG - Intergenic
1130848028 15:87765719-87765741 CTGTAGTTAAGGTGATGACCAGG - Intergenic
1131935640 15:97501324-97501346 CAGTAGTCAAGAAGATGAGTTGG + Intergenic
1133245014 16:4442794-4442816 GTGTGGTCAAGTTGATGATCTGG + Intronic
1134829197 16:17309774-17309796 TTGCAGTCAAGAAGATTAACAGG + Intronic
1134834284 16:17348040-17348062 CTTTGGCCAAGTAGAGGAACTGG - Intronic
1141862396 16:86726771-86726793 CTGGAATCAAGTAGGTTAACAGG - Intergenic
1145089236 17:19972865-19972887 TTGAAGTCATGTAGAAGAACAGG - Intronic
1145251662 17:21300068-21300090 GAGTAAGCAAGTAGATGAACAGG - Intronic
1154940098 18:21103966-21103988 ATGTGTTCAAGAAGATGAACAGG - Intronic
1165087635 19:33362130-33362152 CTGTAGTGGAGGAGATGAAGGGG - Intergenic
925989884 2:9246104-9246126 CTGAAGTCAAGCAGCTGATCAGG - Intronic
929596864 2:43181522-43181544 CTGTACTCCAGTAGCTGAAGGGG + Intergenic
931984432 2:67727902-67727924 CTCTACTCAAGTAGGTGAACAGG + Intergenic
933594009 2:84263718-84263740 CAGTAGCCAATTTGATGAACTGG + Intergenic
933616163 2:84484335-84484357 CTGTACTCAATTAGAAGAATAGG + Intergenic
934566007 2:95341663-95341685 CTGTGGCCAAGTCCATGAACAGG + Intronic
935217981 2:100989297-100989319 CTGTAGTCCAGTAGAGAATCTGG + Intronic
937324598 2:120982950-120982972 CTGTAGTCCAGTAGATAGCCAGG + Intronic
942451161 2:176108554-176108576 CTGGAGTCAAGCAGATGCCCCGG + Intronic
942523740 2:176831140-176831162 CTGTAGCCAAGTAAAGCAACAGG + Intergenic
945529178 2:210928558-210928580 CTGCAGACAAGTGGATGAATCGG + Intergenic
1169080574 20:2795855-2795877 CAGTAATCAAGTGGATGAAGCGG - Exonic
1170760579 20:19246128-19246150 CTGTAGTCAAATAATTTAACTGG - Intronic
1172390479 20:34561801-34561823 CAGCTGTCAACTAGATGAACGGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174714646 20:52744782-52744804 CTGCATTCAACTAGATGAGCAGG - Intergenic
1176350121 21:5786485-5786507 CAGTAGCCAATTCGATGAACTGG + Intergenic
1176356935 21:5907069-5907091 CAGTAGCCAATTCGATGAACTGG + Intergenic
1176544442 21:8184555-8184577 CAGTAGCCAATTCGATGAACTGG + Intergenic
1176563393 21:8367600-8367622 CAGTAGCCAATTCGATGAACTGG + Intergenic
1178440454 21:32593978-32594000 CTGAAGACAAGTAGCTGACCTGG + Intronic
1178612889 21:34101075-34101097 CTGTAGTCACGTAATTTAACAGG - Exonic
1179048468 21:37868223-37868245 CTGTAGTCATGTATATTAATAGG - Intronic
1182908241 22:33957283-33957305 TGGTAGTCAAGTAAATGAGCTGG - Intergenic
1184049756 22:41995741-41995763 CTGTAGTCAAGCACCTGAACAGG + Intronic
957162425 3:76627026-76627048 CTCTATTCAAGGAGATGAAAGGG + Intronic
957727638 3:84087985-84088007 CAGTAGTCAATTCGATCAACTGG + Intergenic
959953842 3:112212569-112212591 CAGTAGCCAATTAGATCAACTGG + Intronic
962017236 3:131454257-131454279 CTGCAGTCCAGTAGGTGAATTGG + Intergenic
964404504 3:156334947-156334969 CTGGAGTCAAGGAAATGATCAGG - Intronic
965146376 3:164910935-164910957 CTAGAGTCAAGGAGATCAACTGG - Intergenic
966067739 3:175836565-175836587 CTGTAGACCAGTAGACAAACTGG + Intergenic
969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG + Intronic
970482447 4:16490169-16490191 CTGTTGTCTAGTAGAAGAATAGG + Intergenic
974706448 4:65522801-65522823 CTGTAGTAAATTGGATGAATAGG - Intronic
975546630 4:75567332-75567354 CTTTAGTCAAATACATCAACTGG - Intergenic
979528396 4:121741360-121741382 CTGTAGTCAAATAGGTGGTCAGG - Intergenic
979650384 4:123123510-123123532 GTGTAGTCATGAAGAAGAACAGG + Intronic
981230035 4:142341948-142341970 CTATAGTCAAGGTGTTGAACGGG - Intronic
982097691 4:151937747-151937769 CTGATGTCAAGTAGATGTCCTGG - Intergenic
986847904 5:11777450-11777472 CTGAAGTTAAGCAGATGAATGGG - Intronic
993917681 5:93762414-93762436 CAGTAGTCAATTCGATCAACTGG + Intronic
995765306 5:115609179-115609201 ATGTAGTCAGTTACATGAACTGG - Intronic
995952796 5:117736964-117736986 ATGTAGTCAGGGAGATGAAATGG - Intergenic
1006253706 6:32812711-32812733 CTGTAATCAAGTCAAGGAACAGG - Intergenic
1008068375 6:47074502-47074524 CTGCAGTGAAGCAGATTAACAGG - Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1010599746 6:77809235-77809257 ATGTAGTGAAATAAATGAACAGG + Intronic
1010688444 6:78878864-78878886 CAGTAGCCGATTAGATGAACTGG + Intronic
1011012389 6:82716563-82716585 CAGTAGCCAATTAGATCAACTGG + Intergenic
1011206967 6:84909975-84909997 CTGTAGTCAGCTATAGGAACTGG + Intergenic
1015327804 6:131943631-131943653 CTGTAGTCCAGAATTTGAACTGG - Intergenic
1015583635 6:134753678-134753700 GTGTAGTCAAGCAAATGAAATGG + Intergenic
1016376594 6:143427447-143427469 CTGTAGTCATGGAGGTGAACTGG + Exonic
1018620346 6:165724840-165724862 CTGTAGTGAGGAAGATGCACTGG - Intronic
1019278616 7:188854-188876 CTGTTGTCATGTGGATGAGCTGG - Intergenic
1020819812 7:12953029-12953051 CTGTAGACTAGTAGTTGAACTGG + Intergenic
1021376968 7:19920526-19920548 CTCTAGTCAAGAAACTGAACAGG - Intergenic
1022793776 7:33715281-33715303 CTGTAATCCAGTTGATGATCTGG - Intergenic
1024566906 7:50688841-50688863 CTGTCGGCAAGCACATGAACAGG + Intronic
1029906767 7:104100645-104100667 CTCTAGTGAAGGAGATGACCAGG - Intergenic
1030820872 7:114088455-114088477 CTGTTGTCAAGCAGCTGAAGTGG + Intronic
1031514937 7:122689562-122689584 CTCTAGTCATGTAGGTGACCAGG + Intronic
1031893123 7:127318350-127318372 CTATAGCCATGTAGATGGACAGG + Intergenic
1032445847 7:131983114-131983136 CAGTAGTCAATTCGATCAACTGG - Intergenic
1034220776 7:149444376-149444398 TTGTCTTCAAGTAGATGAAATGG - Intronic
1035491347 7:159281569-159281591 TTGAAGTCAAGTAGAAGCACTGG - Intergenic
1041889929 8:62857891-62857913 CTGTAGTCATTTAGAAGAAAGGG + Intronic
1042340280 8:67671570-67671592 CTTTAGTCAAGTAGCAGAGCTGG - Intronic
1042555686 8:70032483-70032505 CAGTTGTGAAGTAGATGTACAGG + Intergenic
1049484963 8:142851302-142851324 CAGTAGTCAATTCGATCAACTGG + Intronic
1052370372 9:27657155-27657177 CTGAAGTTTAGTAGATGGACAGG + Intergenic
1059096087 9:111416311-111416333 CTCCAGTCAAGTACATGACCGGG - Exonic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1062257025 9:135630834-135630856 CTGTAGACAAGAAGATAAAATGG + Intronic
1203465708 Un_GL000220v1:84053-84075 CAGTAGCCAATTCGATGAACTGG + Intergenic
1188593648 X:31870059-31870081 CTGAAATGAACTAGATGAACTGG + Intronic
1189937358 X:46083359-46083381 ATGGAGTCAAGAAGATGAAGAGG - Intergenic
1191782131 X:64880042-64880064 CAGTAGTCAATTCGATCAACTGG + Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1192499610 X:71641258-71641280 CTGTAGGCAATTAGAAGCACAGG - Intergenic
1196575902 X:117318726-117318748 CTGTGGTCATGTAGATGAAATGG - Intergenic
1199464484 X:148120562-148120584 CAGTGTTCAAGAAGATGAACAGG + Intergenic