ID: 1118117915

View in Genome Browser
Species Human (GRCh38)
Location 14:62802426-62802448
Sequence GTCCCCGGGAGCACAGTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118117908_1118117915 23 Left 1118117908 14:62802380-62802402 CCACAAAGCAGAGGGCATCCACA 0: 1
1: 0
2: 2
3: 14
4: 196
Right 1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 163
1118117910_1118117915 5 Left 1118117910 14:62802398-62802420 CCACACTTTCTCCAGCATGGTAA 0: 1
1: 0
2: 3
3: 24
4: 202
Right 1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 163
1118117907_1118117915 30 Left 1118117907 14:62802373-62802395 CCTGACACCACAAAGCAGAGGGC 0: 1
1: 0
2: 0
3: 27
4: 241
Right 1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 163
1118117912_1118117915 -6 Left 1118117912 14:62802409-62802431 CCAGCATGGTAAATGAGGTCCCC 0: 1
1: 1
2: 0
3: 7
4: 89
Right 1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG 0: 1
1: 0
2: 1
3: 17
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118117915 Original CRISPR GTCCCCGGGAGCACAGTGAA TGG Exonic
900724826 1:4209034-4209056 GTCACCAGGAGCTCGGTGAACGG - Intergenic
905790451 1:40786490-40786512 GTCCCCGGGAGCCCAGGGCCAGG + Intronic
906223592 1:44103215-44103237 GTGCAGGGGAGCACAGGGAACGG - Intergenic
906276679 1:44521946-44521968 GTGTCTGGGAACACAGTGAAGGG + Intronic
907431438 1:54414412-54414434 GCCCCCGTGGGCACAGTGCAGGG + Intergenic
907635627 1:56131963-56131985 GTCCCCTGGGGCACAGAGCAGGG + Intergenic
909977291 1:82060024-82060046 GCCCCCAAGAGCCCAGTGAAAGG - Intergenic
912739665 1:112182427-112182449 CTCACCGGGAGCATAGTGAATGG - Intergenic
918204972 1:182300229-182300251 GGCCCTGGGAGCTCAGTGGATGG - Intergenic
919264653 1:195246918-195246940 GTTCCCAAGATCACAGTGAATGG + Intergenic
920351409 1:205340438-205340460 TGCCCAGGGAGGACAGTGAAGGG - Intronic
920690902 1:208145599-208145621 GTCCCAGGGACCACAGAGGAAGG - Intronic
1063162787 10:3431708-3431730 ATTCCCAGGAGCACAGGGAATGG - Intergenic
1064158907 10:12926457-12926479 GCCCCAGGGAGCACAAAGAATGG + Intronic
1065102034 10:22340809-22340831 GGCCCGGGAAGCAAAGTGAAAGG + Intergenic
1066219401 10:33320369-33320391 GTTCCCAGCAGCACAGTTAAGGG - Intronic
1073064804 10:100751667-100751689 CTCCCCGAGAGCACACTGGAGGG - Intronic
1073295665 10:102436886-102436908 GTCCCCAGGAGCACTGAGGAAGG - Intergenic
1073483612 10:103802667-103802689 GTCTCCAGGAGGACAGTTAAGGG + Intronic
1075072596 10:119328611-119328633 TTCCCTGGGGCCACAGTGAATGG - Intronic
1077149345 11:1062511-1062533 GAACCCAGGAGCACAGAGAAAGG - Intergenic
1078749812 11:14150798-14150820 GACACAGGGAGCACAGTGTAGGG + Intronic
1079117117 11:17646906-17646928 GTCCCATGGAGCACAGAGACTGG - Intronic
1080880849 11:36319178-36319200 ATCCCTGGGACCACAGTGAAAGG + Intronic
1082128158 11:48456241-48456263 GTACCCGGAAGCAAAGTCAAAGG - Intergenic
1084462932 11:69306374-69306396 CTTCCCGGCAGCAAAGTGAAGGG - Intronic
1084519546 11:69655104-69655126 GTCCCCACGATCCCAGTGAAAGG - Intronic
1089353921 11:117837541-117837563 ATCCCCGGGCGCTCTGTGAAGGG + Exonic
1090598984 11:128350047-128350069 GTCTCCCGGTGCACAGAGAAGGG - Intergenic
1092068445 12:5612742-5612764 GCCCCCTGGAGCACACTGCAGGG + Exonic
1094673845 12:32598862-32598884 GTCCCCAGGATGACAATGAAAGG - Intronic
1096773250 12:53949748-53949770 ATCACAGGGAGCACAGGGAAGGG + Intergenic
1097688699 12:62714277-62714299 GTGCTCGAGAGCACAGAGAATGG + Intronic
1100744906 12:97635070-97635092 GCCCCAGGGAGAAGAGTGAATGG + Intergenic
1102923214 12:116808430-116808452 CTCCCAGGGGGCAGAGTGAAGGG - Intronic
1103395341 12:120602672-120602694 GCCCCCGGGAGGAGACTGAAGGG - Intergenic
1104864284 12:131943546-131943568 GTCCCCTGGAAGGCAGTGAAGGG + Exonic
1105014394 12:132777352-132777374 GGCCCCGAGACCACAGTGCATGG + Intronic
1112224059 13:97520041-97520063 GTCCATGGGAGCACCTTGAAGGG - Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1117942907 14:60988035-60988057 GTTCCAGAGAGCACAGTGGAAGG - Intronic
1118117915 14:62802426-62802448 GTCCCCGGGAGCACAGTGAATGG + Exonic
1118453545 14:65925442-65925464 CTGCCCGAGAGCACAGTGGAAGG - Intergenic
1119495137 14:75071375-75071397 CTCCCCAGGAGCAGAGTTAAAGG + Exonic
1122805453 14:104254065-104254087 GTCCCCGGGAGCTGAGTAAGGGG + Intergenic
1125478327 15:40062795-40062817 GTTCCCGAGAGCAGAGTGAAAGG + Intergenic
1125580218 15:40780024-40780046 GTCCCTGGGATGAGAGTGAATGG - Intronic
1132485745 16:189903-189925 GACCCTGGGAACACAGAGAAGGG + Intronic
1133183291 16:4075648-4075670 GTCCTGGAGAGCTCAGTGAAGGG + Intronic
1134559496 16:15195963-15195985 ATCCACAGGAGCAAAGTGAATGG + Intergenic
1134920035 16:18107574-18107596 ATCCACAGGAGCAAAGTGAATGG + Intergenic
1135732496 16:24906791-24906813 GTCCCCTGGAGCACCCAGAAAGG + Intronic
1136037418 16:27550411-27550433 CTGGCCGGGAGCTCAGTGAAGGG + Intronic
1137727562 16:50667365-50667387 GGCCCTGGGAGCACAGAGAGGGG - Intronic
1140795563 16:78434351-78434373 GTCATCGGGAGCAAAGTGATGGG - Intronic
1141818865 16:86431570-86431592 GAGCTGGGGAGCACAGTGAAGGG + Intergenic
1141952203 16:87346301-87346323 GTGCCCAGGCGCACAGTGAGGGG + Intronic
1142265091 16:89060651-89060673 ATCCCTGGGAGGACAGTGACGGG - Intergenic
1143055109 17:4156607-4156629 GGGCTGGGGAGCACAGTGAAAGG + Intronic
1144980323 17:19164233-19164255 GTCTCCGGGTTCACAGTGATAGG - Intergenic
1144987899 17:19213999-19214021 GTCTCCGGGTTCACAGTGATAGG + Intergenic
1145748283 17:27336619-27336641 GTCTCCGGGGGCACAGAGAAAGG + Intergenic
1146159762 17:30553603-30553625 CTCCCTAGGAGCACAGTGCAGGG + Intergenic
1146274859 17:31510145-31510167 GTCCCCAGGTCCACAGGGAAGGG - Intronic
1148326981 17:46789098-46789120 GACGCCGGGAGCACAGTGCGTGG + Intronic
1149863762 17:60139123-60139145 GACCCCGGAGGCACAGCGAACGG + Intergenic
1151674620 17:75591079-75591101 GGCCCCGGGACCTCAGTCAAGGG - Intergenic
1153708311 18:7770207-7770229 GTCCCCTGAAACACAGTAAAAGG - Intronic
1154085724 18:11303282-11303304 GTCCCCAGGGGCACAGAGACAGG - Intergenic
1154292769 18:13124555-13124577 GTCCCAGGCAGCACAGTGCCTGG - Intronic
1158857453 18:61557122-61557144 GTCCCTGGGAGGATAGTTAATGG + Intergenic
1160619621 18:80161641-80161663 GTCTCGGGGAGCAGAGGGAAGGG + Intronic
1160733681 19:652282-652304 CTCCCCAGGAGCACAGAAAATGG - Exonic
1160857521 19:1224162-1224184 GCCCCCGAGAGCACAGTGTATGG + Intronic
1161167545 19:2796462-2796484 GTCCCAGGGAGCACTGGGCATGG + Intronic
1161314585 19:3611875-3611897 GTCCTCGGGGGCACAGTAAAGGG - Exonic
1161375598 19:3937768-3937790 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375616 19:3937814-3937836 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375634 19:3937860-3937882 GACCCCGGGGGAACAGTGGACGG - Intronic
1161375651 19:3937906-3937928 GACCCCGGGGGAACAGTGGACGG - Intronic
1161375668 19:3937952-3937974 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375686 19:3937998-3938020 GACCCCGGGGGGACAGTGGAGGG - Intronic
1161375703 19:3938044-3938066 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375735 19:3938136-3938158 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375767 19:3938228-3938250 GACCCCGGGGGGACAGTGGACGG - Intronic
1161375802 19:3938319-3938341 GACCCCGGGGGAACAGTGGACGG - Intronic
1161375834 19:3938410-3938432 GACCCCGGGGGAACAGTGGACGG - Intronic
1161375850 19:3938456-3938478 GACCCCGGGGGGACAGTGGACGG - Intronic
1162463871 19:10829587-10829609 GCCTCCTGGAGCACAGAGAAGGG + Intronic
1162937355 19:13987779-13987801 TTCCCTGGGACCACTGTGAAAGG + Intronic
1164642701 19:29838082-29838104 TTTCCCGGGAGCACAGTGCAGGG - Intergenic
1167865858 19:52327294-52327316 TTCCCAGAGACCACAGTGAAAGG - Intergenic
1167876391 19:52417213-52417235 TTCCCAGGGACCACAGTGAATGG - Exonic
1167879320 19:52442699-52442721 TTCCCAGAGACCACAGTGAAAGG - Intronic
938851508 2:135265658-135265680 GTTACAGGGAGCACACTGAACGG - Exonic
940321902 2:152386264-152386286 GCACCCGGGATTACAGTGAAAGG - Intronic
946289074 2:218729381-218729403 GTTCCTGGGACCACAGAGAAGGG - Intronic
946320776 2:218953310-218953332 GTGCAGGGGAGCACAGGGAATGG - Intergenic
948509490 2:238454095-238454117 CTCCCCAGGAGCACAGCAAAAGG + Intergenic
948515392 2:238500189-238500211 AGCCCCTGGGGCACAGTGAATGG + Intergenic
948721582 2:239904181-239904203 GTCCCCCGGGGCACACTGGAAGG - Intronic
1168762717 20:360346-360368 GTCCCTGGGAGCACTGTGCTAGG + Intergenic
1171084351 20:22223709-22223731 CGCCCTGGGAGTACAGTGAATGG + Intergenic
1174854153 20:54026966-54026988 GGCACAGGGACCACAGTGAAGGG - Intronic
1175294968 20:57902117-57902139 TTCCTGGAGAGCACAGTGAAGGG + Intergenic
1175309681 20:58003124-58003146 GTACCTGGGAGCTCAGTGATGGG - Intergenic
1175680749 20:60986799-60986821 TTCTCCGGGAGCACTGGGAATGG - Intergenic
1175803847 20:61816525-61816547 GTCTCAGGGAGCAGAGAGAATGG - Intronic
1175905623 20:62378050-62378072 GGCCCTGGGGCCACAGTGAATGG - Intergenic
1176231306 20:64034402-64034424 GTCCCCAGAACCACAGGGAAGGG - Intronic
1176264325 20:64200914-64200936 GTCCCCGGAAGCACAGGGGTCGG + Intronic
1177862704 21:26473569-26473591 GTTCCACTGAGCACAGTGAAGGG - Intronic
1180200170 21:46219413-46219435 GTCCCGGGGAGTAGAGTGACAGG - Intronic
1183714308 22:39524737-39524759 GAGGCCGGGAGCACAGTGAGGGG - Intergenic
1184282749 22:43447761-43447783 GTCCTCGGGAGAACAGAGAAGGG - Intronic
1184737852 22:46409670-46409692 GTGCCCGGGACCACCGTGAGGGG - Intronic
1184898775 22:47430720-47430742 GTCCCCGGAAGCTCAGAGCAGGG - Intergenic
1185380560 22:50505827-50505849 GTCTCCGGGAGCACTGAGAGCGG - Intronic
950502006 3:13370490-13370512 GTCCCCGGGAGGAAAGTTCAGGG - Intronic
950706972 3:14788853-14788875 GTCCCCGGGGCAACAGTGACTGG - Intergenic
953882119 3:46696020-46696042 GTCCCCTGCAGCACAGCCAAGGG + Intergenic
955192056 3:56770678-56770700 GTCCTTGGGGGGACAGTGAATGG - Intronic
955370043 3:58343347-58343369 GTCCGTGAGAGCACAGGGAATGG + Intronic
955751896 3:62191808-62191830 GTGCCGGGGAGGACAGTGGATGG + Intronic
957200902 3:77134927-77134949 GGCCCGGGGAGCGCAGTGAACGG - Intronic
961115331 3:124324180-124324202 GTCCCAGGAAGCATAGTGAAAGG - Intronic
961408730 3:126703401-126703423 CGCCCCGGGAGGACAGGGAATGG - Intergenic
961511237 3:127405091-127405113 GTCCCCGGTAGCACAGAGCGCGG + Intergenic
963238061 3:142974787-142974809 TTCCCAGGGTGCACAGTGAGAGG + Intronic
967273499 3:187750566-187750588 CTCCACGGGGGCACAGTGTAGGG + Intergenic
968278358 3:197457662-197457684 TTCCCGGGGAGAACAGTGACGGG + Intergenic
968903268 4:3440816-3440838 GGCCCTGGGGGCACGGTGAATGG - Intergenic
968949424 4:3682922-3682944 GTTCCCGGGAGCACAGGGAGTGG + Intergenic
968955027 4:3713990-3714012 TTCCCTGGCTGCACAGTGAAGGG + Intergenic
972365179 4:38367847-38367869 GTCCCCTGGATCACAGGGCAAGG - Intergenic
976083274 4:81380090-81380112 ATCTCAGGGAGCTCAGTGAAAGG - Intergenic
985639148 5:1055397-1055419 GTCCCCGGGAGCACACTTAACGG - Intronic
990151689 5:52825109-52825131 GTTCCCAGGAGCAGAGGGAAGGG - Intronic
990900394 5:60743467-60743489 GTGCAGGGGAGCACAGGGAATGG - Intergenic
995214666 5:109581737-109581759 GTCCTCAAGAGCATAGTGAATGG - Intergenic
997732393 5:136191216-136191238 GTCCCCAGGAGCCCTGTTAATGG + Intergenic
997981512 5:138470394-138470416 CTCTTTGGGAGCACAGTGAAGGG + Intergenic
998952375 5:147404971-147404993 GTCCCTAGGAGCACTGTGACTGG - Intronic
999098776 5:149005068-149005090 GTCCCAAGGACCACAGTGGAGGG - Intronic
999481812 5:151955485-151955507 CTCCCCTCGTGCACAGTGAATGG - Intergenic
1000384177 5:160658258-160658280 GTCCATGGGAGCACAGAGGAAGG + Intronic
1003257051 6:4483718-4483740 GACCACGGGAGCACAGGTAAGGG + Intergenic
1005136683 6:22576789-22576811 GTCCCCTGGAAAACAGTGAATGG - Intergenic
1005996090 6:30932274-30932296 TTCCCCAAAAGCACAGTGAATGG - Intergenic
1006914312 6:37584830-37584852 GACACCAGGAGCACAGAGAAGGG - Intergenic
1007524596 6:42480734-42480756 GTCCCAGGAAGCACAGTGAGAGG - Intergenic
1012244933 6:96915463-96915485 GTGCCCGAGAGCTCAGTGGAAGG + Intergenic
1017526203 6:155243292-155243314 GCCTCAGGGAGCACAGTGAGAGG - Intronic
1018696879 6:166397542-166397564 GGGCCCCGGAGCACAGAGAAAGG - Intergenic
1019444458 7:1064171-1064193 CTCCCCGGGAACACCGTGACCGG + Intronic
1020054630 7:5108922-5108944 TTCGCCTGGGGCACAGTGAAGGG - Intergenic
1023941078 7:44768705-44768727 GTCCCTGGGAGCACAAAGGAGGG - Exonic
1032773175 7:135080481-135080503 TTCCCAGGGAGCAGAGAGAAAGG + Intronic
1032895863 7:136250144-136250166 ATTCCTGGGAGCACAGTGAGTGG - Intergenic
1034696483 7:153058659-153058681 GTCCCTGGCAGCAGAGTGAAAGG - Intergenic
1034740628 7:153470538-153470560 GTCCCCTGGAGCACAGAGTGTGG + Intergenic
1035272607 7:157729387-157729409 GTCCACGGGAGCAGAGTGGGGGG - Intronic
1035403772 7:158586065-158586087 GGCCCTGGGGGCACAGTGACTGG + Intronic
1036028060 8:4932806-4932828 GAACCAGGGAGCACAGGGAAGGG - Intronic
1037386295 8:18346081-18346103 GCCATCTGGAGCACAGTGAAAGG + Intergenic
1037792460 8:21957771-21957793 ATCCCAGTGAGCACAGTGCATGG - Intronic
1039247134 8:35621290-35621312 GAGCCCGGGATCACAGTGTAGGG + Intronic
1044944262 8:97376040-97376062 GTCCCAGGGAGAAAAGAGAAGGG - Intergenic
1048867419 8:138771096-138771118 GGCCCCAGGATCACAGTGCAGGG + Intronic
1049018974 8:139941002-139941024 GTCCCAGTGAGGACAGTGATGGG - Intronic
1049658709 8:143810213-143810235 GTGCCTGGGAGCACAGGGAATGG - Intronic
1049732139 8:144184035-144184057 CTCCCAGGGTGCACAGTGGAAGG - Intronic
1050143167 9:2538052-2538074 GACCCCTGGAACTCAGTGAAAGG - Intergenic
1053278520 9:36801220-36801242 GTCACCTGGAGCAGAGTGACTGG + Intergenic
1055611008 9:78024269-78024291 GCCACCGGGCGCACAGTGAAAGG - Intronic
1056802204 9:89700152-89700174 GTCCATGGGAGGACAGAGAAGGG - Intergenic
1062009082 9:134257440-134257462 GTCCCCCGGTGCACAGTGCTGGG - Intergenic
1062440646 9:136567809-136567831 GTGGCCCTGAGCACAGTGAAAGG - Intergenic
1185493573 X:537536-537558 GTCTCTGGGAGGACAGTGCATGG - Intergenic
1189893677 X:45632196-45632218 GTGCAGGGGAGCACAGGGAACGG - Intergenic
1191254429 X:58273660-58273682 GTCCCCTGGAGAACAGAGACAGG - Intergenic
1197638968 X:128947239-128947261 GTGCCAGGGGACACAGTGAATGG - Intergenic